FOXP3 | GeneID:50943 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 50943 Official Symbol FOXP3
Locus N/A Gene Type protein-coding
Synonyms AIID; DIETER; IPEX; JM2; MGC141961; MGC141963; PIDX; XPID
Full Name forkhead box P3
Description forkhead box P3
Chromosome Xp11.23
Also Known As FOXP3delta7; OTTHUMP00000025832; immune dysregulation, polyendocrinopathy, enteropathy, X-linked; immunodeficiency, polyendocrinopathy, enteropathy, X-linked; scurfin
Summary The protein encoded by this gene is a member of the forkhead/winged-helix family of transcriptional regulators. Defects in this gene are the cause of immunodeficiency polyendocrinopathy, enteropathy, X-linked syndrome (IPEX), also known as X-linked autoimmunity-immunodeficiency syndrome. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 8516

ID Symbol Protein Species
GeneID:20371 Foxp3 NP_473380.1 Mus musculus
GeneID:50943 FOXP3 NP_054728.2 Homo sapiens
GeneID:317382 Foxp3 XP_228771.4 Rattus norvegicus
GeneID:491876 FOXP3 XP_548996.2 Canis lupus familiaris
GeneID:506053 FOXP3 NP_001039398.1 Bos taurus
GeneID:740909 FOXP3 XP_001143169.1 Pan troglodytes

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab2481 FOXP3 antibody (ab2481); Goat polyclonal to FOXP3
2 abcam ab72008 FOXP3 (exon 2 deleted) antibody [16J4G6] (ab72008); Mouse monoclonal [16J4G6] to FOXP3 (exon 2 deleted)
3 abcam ab51904 FOXP3 antibody [3G3] (ab51904); Mouse monoclonal [3G3] to FOXP3
4 abcam ab45122 FOXP3 antibody [3G3] (Phycoerythrin) (ab45122); Mouse monoclonal [3G3] to FOXP3 (Phycoerythrin)
5 abcam ab36607 FOXP3 antibody [2A11G9] (ab36607); Mouse monoclonal [2A11G9] to FOXP3
6 abcam ab4728 FOXP3 antibody (ab4728); Rabbit polyclonal to FOXP3
7 abcam ab22273 FOXP3 antibody (HRP) (ab22273); Rabbit polyclonal to FOXP3 (HRP)
8 abcam ab22509 FOXP3 antibody [mAbcam 22509] (ab22509); Mouse monoclonal [mAbcam 22509] to FOXP3
9 abcam ab22510 FOXP3 antibody [mAbcam 22510] (ab22510); Mouse monoclonal [mAbcam 22510] to FOXP3
10 abcam ab22831 FOXP3 antibody [mAbcam 22510] (HRP) (ab22831); Mouse monoclonal [mAbcam 22510] to FOXP3 (HRP)
11 abcam ab22511 FOXP3 antibody [mAbcam 22511] (ab22511); Mouse monoclonal [mAbcam 22511] to FOXP3
12 abcam ab450 FOXP3 antibody [mAbcam 450] (ab450); Mouse monoclonal [mAbcam 450] to FOXP3
13 abcam ab20034 FOXP3 antibody [236A/E7] (ab20034); Mouse monoclonal [236A/E7] to FOXP3
14 abcam ab10563 FOXP3 antibody (ab10563); Rabbit polyclonal to FOXP3
15 abcam ab10901 FOXP3 antibody (ab10901); Rabbit polyclonal to FOXP3
16 abgent AP2795b FOXP3 Antibody (C-term); Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
17 acris AP05296CP-N FOXP3 / Scurfin Control Peptide; antibody Ab/CP
18 acris AP05296SU-N FOXP3 / Scurfin; antibody
19 acris AP05296PU-N FOXP3 / Scurfin; antibody
20 acris AP15562PU-S FOXP3 / Scurfin; antibody Ab
21 acris AP15959PU-N FOXP3 / Scurfin (C-term); antibody Ab
22 acris AP15562PU-N FOXP3 / Scurfin; antibody Ab
23 acris AP15563PU-S FOXP3 / Scurfin (C-term); antibody Ab
24 acris AP15563PU-N FOXP3 / Scurfin (C-term); antibody Ab
25 acris AP12444PU-N FOXP3 / Scurfin (C-term); antibody Ab
26 scbt FOXP3 FOXP3 Antibody / FOXP3 Antibodies;
27 sigma HPA003191 Anti-FOXP3 antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of FOXP3 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of FOXP3 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005622 Component intracellular
GO:0005634 Component nucleus
GO:0043234 Component protein complex
GO:0016565 Function general transcriptional repressor activity
GO:0046872 Function metal ion binding
GO:0051525 Function NFAT protein binding
GO:0051059 Function NF-kappaB binding
GO:0005515 Function protein binding
GO:0042803 Function protein homodimerization activity
GO:0043565 Function sequence-specific DNA binding
GO:0003700 Function transcription factor activity
GO:0008270 Function zinc ion binding
GO:0006338 Process chromatin remodeling
GO:0046007 Process negative regulation of activated T cell proliferation
GO:0008285 Process negative regulation of cell proliferation
GO:0032792 Process negative regulation of CREB transcription factor activity
GO:0050710 Process negative regulation of cytokine secretion
GO:0050777 Process negative regulation of immune response
GO:0032689 Process negative regulation of interferon-gamma production
GO:0032693 Process negative regulation of interleukin-10 production
GO:0045085 Process negative regulation of interleukin-2 biosynthetic process
GO:0032703 Process negative regulation of interleukin-2 production
GO:0032713 Process negative regulation of interleukin-4 production
GO:0032088 Process negative regulation of NF-kappaB transcription factor activity
GO:0002725 Process negative regulation of T cell cytokine production
GO:0045892 Process negative regulation of transcription, DNA-dependent
GO:0045941 Process positive regulation of transcription
GO:0042110 Process T cell activation
GO:0043029 Process T cell homeostasis

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001114377  UCSC Browser NP_001107849
2 NM_014009  UCSC Browser NP_054728

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000376199 MI0000063 hsa-let-7b UGAGGUAGUAGGUUGUGUGGUU
ENST00000376199 MI0000450 hsa-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENST00000376199 MI0000451 hsa-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENST00000376199 MI0000822 hsa-miR-133b UUUGGUCCCCUUCAACCAGCUA
ENST00000376199 MI0000487 hsa-miR-193a-5p UGGGUCUUUGCGGGCGAGAUGA
ENST00000376199 MI0000239 hsa-miR-197 UUCACCACCUUCUCCACCCAGC
ENST00000376199 MI0000286 hsa-miR-210 CUGUGCGUGUGACAGCGGCUGA
ENST00000376199 MI0000078 hsa-miR-22 AAGCUGCCAGUUGAAGAACUGU
ENST00000376199 MI0005529 hsa-miR-220b CCACCACCGUGUCUGACACUU
ENST00000376199 MI0000298 hsa-miR-221* ACCUGGCAUACAAUGUAGAUUU
ENST00000376199 MI0000082 hsa-miR-25* AGGCGGAGACUUGGGCAAUUG
ENST00000376199 MI0000089 hsa-miR-31 AGGCAAGAUGCUGGCAUAGCU
ENST00000376199 MI0000813 hsa-miR-324-3p ACUGCCCCAGGUGCUGCUGG
ENST00000376199 MI0000815 hsa-miR-339-5p UCCCUGUCCUCCAGGAGCUCACG
ENST00000376199 MI0000783 hsa-miR-375 UUUGUUCGUUCGGCUCGCGUGA
ENST00000376199 MI0001445 hsa-miR-423-5p UGAGGGGCAGAGAGCGAGACUUU
ENST00000376199 MI0003820 hsa-miR-454* ACCCUAUCAAUAUUGUCUCUGC
ENST00000376199 MI0003174 hsa-miR-517c AUCGUGCAUCCUUUUAGAGUGU
ENST00000376199 MI0003580 hsa-miR-573 CUGAAGUGAUGUGUAACUGAUCAG
ENST00000376199 MI0003592 hsa-miR-585 UGGGCGUAUCUGUAUGCUA
ENST00000376199 MI0003659 hsa-miR-644 AGUGUGGCUUUCUUAGAGC
ENST00000376199 MI0003662 hsa-miR-647 GUGGCUGCACUCACUUCCUUC
ENST00000376199 MI0003757 hsa-miR-758 UUUGUGACCUGGUCCACUAACC
ENST00000376199 MI0005567 hsa-miR-760 CGGCUCUGGGUCUGUGGGGA
ENST00000376199 MI0005715 hsa-miR-923 GUCAGCGGAGGAAAAGAAACU
ENST00000376199 MI0000094 hsa-miR-92a-2* GGGUGGGGAUUUGUUGCAUUAC
ENST00000376199 MI0003560 hsa-miR-92b* AGGGACGGGACGCGGUGCAGUG
ENST00000376199 MI0005761 hsa-miR-939 UGGGGAGCUGAGGCUCUGGGGGUG
ENST00000376199 MI0001526 mmu-miR-434-5p GCUCGACUCAUGGUUUGAACCA
ENST00000376199 MI0002400 mmu-miR-465a-3p GAUCAGGGCCUUUCUAAGUAGA
ENST00000376199 MI0002404 mmu-miR-469 UGCCUCUUUCAUUGAUCUUGGUGUCC
ENST00000376199 MI0004553 mmu-miR-666-3p GGCUGCAGCGUGAUCGCCUGCU
ENST00000376199 MI0004553 mmu-miR-666-5p AGCGGGCACAGCUGUGAGAGCC
ENST00000376199 MI0004666 mmu-miR-669b AGUUUUGUGUGCAUGUGCAUGU
ENST00000376199 MI0004601 mmu-miR-673-3p UCCGGGGCUGAGUUCUGUGCACC
ENST00000376199 MI0004683 mmu-miR-699 AGGCAGUGCGACCUGGCUCG
ENST00000376199 MI0004215 mmu-miR-762 GGGGCUGGGGCCGGGACAGAGC
ENST00000376199 MI0000635 rno-miR-347 UGUCCCUCUGGGUCGCCCA
ENST00000376199 MI0000636 rno-miR-349 CAGCCCUGCUGUCUUAACCUCU
ENST00000376207 MI0000469 hsa-miR-125a-3p ACAGGUGAGGUUCUUGGGAGCC
ENST00000376207 MI0000450 hsa-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENST00000376207 MI0000451 hsa-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENST00000376207 MI0000822 hsa-miR-133b UUUGGUCCCCUUCAACCAGCUA
ENST00000376207 MI0000487 hsa-miR-193a-5p UGGGUCUUUGCGGGCGAGAUGA
ENST00000376207 MI0000239 hsa-miR-197 UUCACCACCUUCUCCACCCAGC
ENST00000376207 MI0000286 hsa-miR-210 CUGUGCGUGUGACAGCGGCUGA
ENST00000376207 MI0005529 hsa-miR-220b CCACCACCGUGUCUGACACUU
ENST00000376207 MI0000298 hsa-miR-221* ACCUGGCAUACAAUGUAGAUUU
ENST00000376207 MI0000089 hsa-miR-31 AGGCAAGAUGCUGGCAUAGCU
ENST00000376207 MI0000808 hsa-miR-326 CCUCUGGGCCCUUCCUCCAG
ENST00000376207 MI0000783 hsa-miR-375 UUUGUUCGUUCGGCUCGCGUGA
ENST00000376207 MI0003820 hsa-miR-454* ACCCUAUCAAUAUUGUCUCUGC
ENST00000376207 MI0003659 hsa-miR-644 AGUGUGGCUUUCUUAGAGC
ENST00000376207 MI0005712 hsa-miR-920 GGGGAGCUGUGGAAGCAGUA
ENST00000376207 MI0005715 hsa-miR-923 GUCAGCGGAGGAAAAGAAACU
ENST00000376207 MI0001526 mmu-miR-434-5p GCUCGACUCAUGGUUUGAACCA
ENST00000376207 MI0005546 mmu-miR-466d-5p UGUGUGUGCGUACAUGUACAUG
ENST00000376207 MI0005507 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000376207 MI0005508 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000376207 MI0005509 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000376207 MI0005511 mmu-miR-466h UGUGUGCAUGUGCUUGUGUGUA
ENST00000376207 MI0004553 mmu-miR-666-3p GGCUGCAGCGUGAUCGCCUGCU
ENST00000376207 MI0004553 mmu-miR-666-5p AGCGGGCACAGCUGUGAGAGCC
ENST00000376207 MI0004601 mmu-miR-673-3p UCCGGGGCUGAGUUCUGUGCACC
ENST00000376207 MI0004644 mmu-miR-682 CUGCAGUCACAGUGAAGUCUG
ENST00000376207 MI0004677 mmu-miR-696 GCGUGUGCUUGCUGUGGG
ENST00000376207 MI0004215 mmu-miR-762 GGGGCUGGGGCCGGGACAGAGC
ENST00000376207 MI0000635 rno-miR-347 UGUCCCUCUGGGUCGCCCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Cyclophosphamide
  • Cyclophosphamide results in decreased expression of FOXP3 mRNA
15591121

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Breast Neoplasms marker 17570480
Diabetes Mellitus, Type 1 marker
IMMUNODYSREGULATION, POLYENDOCRINOPATHY, AND ENTEROPATHY, X-LINKED marker
Arteriosclerosis inferred via Cyclophosphamide 15014928
Breast Neoplasms inferred via Cyclophosphamide 17388661, 11325840, 16978400, 15136595, 15093573, 12006526, 18323546, 18234424
Carcinoma, Lewis Lung inferred via Cyclophosphamide 16152834
Carcinoma, Renal Cell inferred via Cyclophosphamide 16201981
Cystitis inferred via Cyclophosphamide 11948286, 18295254, 16614059, 17010015, 10700343, 16413132, 16651033, 16989017, 12388444, 10498854, 15643279, 12913760, 18483878, 18710439, 17979934, 15276878, 18433785
Diabetes Mellitus, Experimental inferred via Cyclophosphamide 11751995, 10990075, 15331540
Diabetes Mellitus, Type 1 inferred via Cyclophosphamide 18772604
Eosinophilia inferred via Cyclophosphamide 11006010
Gliosarcoma inferred via Cyclophosphamide 11389073
GLOBOZOOSPERMIA inferred via Cyclophosphamide 16517039
Graft vs Host Disease inferred via Cyclophosphamide 11014644, 16376943, 15172196
Hemophilia A inferred via Cyclophosphamide 11918545
Hepatic Veno-Occlusive Disease inferred via Cyclophosphamide 14986274
Hodgkin Disease inferred via Cyclophosphamide 17606976, 16135485
Infertility, Male inferred via Cyclophosphamide 16517039
Leukemia inferred via Cyclophosphamide 10602166
Leukemia, Lymphocytic, Chronic, B-Cell inferred via Cyclophosphamide 18587576, 17008537, 17658394, 17296974, 18172266, 17802794
Leukopenia inferred via Cyclophosphamide 10052129, 11830472
Lymphoma inferred via Cyclophosphamide 12854902
Lymphoma, B-Cell inferred via Cyclophosphamide 16675587
Lymphoma, Non-Hodgkin inferred via Cyclophosphamide 11911406
Melanoma, Experimental inferred via Cyclophosphamide 16388313
Neuroblastoma inferred via Cyclophosphamide 16115947, 15176712
Oligospermia inferred via Cyclophosphamide 16517039
Pancreatic Neoplasms inferred via Cyclophosphamide 11332152
Prostatic Neoplasms inferred via Cyclophosphamide 17136230
Pulmonary Fibrosis inferred via Cyclophosphamide 16636934
Scleroderma, Systemic inferred via Cyclophosphamide 16636934
Urinary Bladder Neoplasms inferred via Cyclophosphamide 14692829

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Hoffmann P, et al. (2009) "Loss of FOXP3 expression in natural human CD4+CD25+ regulatory T cells upon repetitive in vitro stimulation." Eur J Immunol. 39(4):1088-1097. PMID:19283780
  2. [ + ] Scott ME, et al. (2009) "Diminished IFN-gamma and IL-10 and elevated Foxp3 mRNA expression in the cervix are associated with CIN 2 or 3." Int J Cancer. 124(6):1379-1383. PMID:19089920
  3. [ + ] De Jager PL, et al. (2009) "The role of the CD58 locus in multiple sclerosis." Proc Natl Acad Sci U S A. 106(13):5264-5269. PMID:19237575
  4. [ + ] Lucas JL, et al. (2009) "Induction of Foxp3+ regulatory T cells with histone deacetylase inhibitors." Cell Immunol. 257(1-2):97-104. PMID:19358983
  5. [ + ] Villano MJ, et al. (2009) "Autoimmune thyroiditis and diabetes: dissecting the joint genetic susceptibility in a large cohort of multiplex families." J Clin Endocrinol Metab. 94(4):1458-1466. PMID:19141582
  6. [ + ] da Silveira AB, et al. (2009) "Characterization of the presence and distribution of Foxp3(+) cells in chagasic patients with and without megacolon." Hum Immunol. 70(1):65-67. PMID:19022313
  7. [ + ] Bourreau E, et al. (2009) "In leishmaniasis due to Leishmania guyanensis infection, distinct intralesional interleukin-10 and Foxp3 mRNA expression are associated with unresponsiveness to treatment." J Infect Dis. 199(4):576-579. PMID:19125672
  8. [ + ] Lee SM, et al. (2009) "Decreased FoxP3 gene expression in the nasal secretions from patients with allergic rhinitis." Otolaryngol Head Neck Surg. 140(2):197-201. PMID:19201288
  9. [ + ] Liu R, et al. (2009) "FOXP3 up-regulates p21 expression by site-specific inhibition of histone deacetylase 2/histone deacetylase 4 association to the locus." Cancer Res. 69(6):2252-2259. PMID:19276356
  10. [ + ] Ayyoub M, et al. (2009) "Human memory FOXP3+ Tregs secrete IL-17 ex vivo and constitutively express the T(H)17 lineage-specific transcription factor RORgamma t." Proc Natl Acad Sci U S A. 106(21):8635-8640. PMID:19439651
  11. [ + ] Merlo A, et al. (2009) "FOXP3 expression and overall survival in breast cancer." J Clin Oncol. 27(11):1746-1752. PMID:19255331
  12. [ + ] Bonelli M, et al. (2009) "Phenotypic and functional analysis of CD4+ CD25- Foxp3+ T cells in patients with systemic lupus erythematosus." J Immunol. 182(3):1689-1695. PMID:19155519
  13. [ + ] Vorobjova T, et al. (2009) "Increased FOXP3 expression in small-bowel mucosa of children with coeliac disease and type I diabetes mellitus." Scand J Gastroenterol. 44(4):422-430. PMID:19096978
  14. [ + ] Kleinewietfeld M, et al. (2009) "CD49d provides access to "untouched" human Foxp3+ Treg free of contaminating effector cells." Blood. 113(4):827-836. PMID:18941119
  15. [ + ] Iwase K, et al. (2009) "FOXP3/Scurfin gene polymorphism is associated with adult onset type 1 diabetes in Japanese, especially in women and slowly progressive-type patients." Autoimmunity. 42(2):159-167. PMID:19085184
  16. [ + ] Ouaked N, et al. (2009) "Regulation of the foxp3 gene by the Th1 cytokines: the role of IL-27-induced STAT1." J Immunol. 182(2):1041-1049. PMID:19124747
  17. [ + ] Su MA, et al. (2009) "The role of X-linked FOXP3 in the autoimmune susceptibility of Turner Syndrome patients." Clin Immunol. 131(1):139-144. PMID:19150256
  18. [ + ] Sarrazin H, et al. (2009) "Association between tuberculin skin test reactivity, the memory CD4 cell subset, and circulating FoxP3-expressing cells in HIV-infected persons." J Infect Dis. 199(5):702-710. PMID:19199536
  19. [ + ] Siezen CL, et al. (2009) "Genetic susceptibility to respiratory syncytial virus bronchiolitis in preterm children is associated with airway remodeling genes and innate immune genes." Pediatr Infect Dis J. 28(4):333-335. PMID:19258923
  20. [ + ] Voo KS, et al. (2009) "Identification of IL-17-producing FOXP3+ regulatory T cells in humans." Proc Natl Acad Sci U S A. 106(12):4793-4798. PMID:19273860
  21. [ + ] Sakamoto R, et al. (2009) "Forkhead box P3 (FOXP3) mRNA expression immediately after living-donor liver transplant." Exp Clin Transplant. 7(1):8-12. PMID:19364305
  22. [ + ] Stanilov N, et al. (2009) "High expression of Foxp3, IL-23p19 and survivin mRNA in colorectal carcinoma." Int J Colorectal Dis. 24(2):151-157. PMID:18825388
  23. [ + ] Nejentsev S, et al. (2009) "Rare variants of IFIH1, a gene implicated in antiviral responses, protect against type 1 diabetes." Science. 324(5925):387-389. PMID:19264985
  24. [ + ] Raskin L, et al. (2009) "FOXP3 germline polymorphisms are not associated with risk of breast cancer." Cancer Genet Cytogenet. 190(1):40-42. PMID:19264232
  25. [ + ] Lu H, et al. (2009) "FOXP3 expression and prognosis: role of both the tumor and T cells." J Clin Oncol. 27(11):1735-1736. PMID:19255314
  26. [ + ] Bourreau E, et al. (2009) "Intralesional regulatory T-cell suppressive function during human acute and chronic cutaneous leishmaniasis due to Leishmania guyanensis." Infect Immun. 77(4):1465-1474. PMID:19168733
  27. [ + ] Eisenberger U, et al. (2009) "FoxP3 positive T cells in graft biopsies from living donor kidney transplants after donor-specific transfusions." Transplantation. 87(1):138-142. PMID:19136904
  28. [ + ] Grant J, et al. (2009) "Validated protocol for FoxP3 reveals increased expression in type 1 diabetes patients." Cytometry B Clin Cytom. 76(2):69-78. PMID:18690669
  29. [ + ] Bonzheim I, et al. (2008) "Evaluation of FoxP3 expression in peripheral T-cell lymphoma." Am J Clin Pathol. 130(4):613-619. PMID:18794055
  30. [ + ] Shimauchi T, et al. (2008) "Adult T-cell leukemia/lymphoma cells from blood and skin tumors express cytotoxic T lymphocyte-associated antigen-4 and Foxp3 but lack suppressor activity toward autologous CD8+ T cells." Cancer Sci. 99(1):98-106. PMID:17970785
  31. [ + ] Solomon GJ, et al. (2008) "Foxp3 expression in cutaneous T-cell lymphocytic infiltrates." J Cutan Pathol. 35(11):1032-1039. PMID:18681861
  32. [ + ] Krejsgaard T, et al. (2008) "Malignant Tregs express low molecular splice forms of FOXP3 in Sezary syndrome." Leukemia. 22(12):2230-2239. PMID:18769452
  33. [ + ] Christodoulou MI, et al. (2008) "Foxp3+ T-regulatory cells in Sjogren's syndrome: correlation with the grade of the autoimmune lesion and certain adverse prognostic factors." Am J Pathol. 173(5):1389-1396. PMID:18818377
  34. [ + ] Zheng Y, et al. (2008) "Acquisition of suppressive function by activated human CD4+ CD25- T cells is associated with the expression of CTLA-4 not FoxP3." J Immunol. 181(3):1683-1691. PMID:18641304
  35. [ + ] Li Y, et al. (2008) "IL-21 mediated Foxp3 suppression leads to enhanced generation of antigen-specific CD8+ cytotoxic T lymphocytes." Blood. 111(1):229-235. PMID:17921346
  36. [ + ] Kandulski A, et al. (2008) "Naturally occurring regulatory T cells (CD4+, CD25high, FOXP3+) in the antrum and cardia are associated with higher H. pylori colonization and increased gene expression of TGF-beta1." Helicobacter. 13(4):295-303. PMID:18665940
  37. [ + ] Wang R, et al. (2008) "Identification of a regulatory T cell specific cell surface molecule that mediates suppressive signals and induces Foxp3 expression." PLoS ONE. 3(7):e2705. PMID:18628982
  38. [ + ] Jiang Q, et al. (2008) "FoxP3+CD4+ regulatory T cells play an important role in acute HIV-1 infection in humanized Rag2-/-gammaC-/- mice in vivo." Blood. 112(7):2858-2868. PMID:18544681
  39. [ + ] Scotta C, et al. (2008) "FOXP3 induced by CD28/B7 interaction regulates CD25 and anergic phenotype in human CD4+CD25- T lymphocytes." J Immunol. 181(2):1025-1033. PMID:18606654
  40. [ + ] Fragale A, et al. (2008) "IFN regulatory factor-1 negatively regulates CD4+ CD25+ regulatory T cell differentiation by repressing Foxp3 expression." J Immunol. 181(3):1673-1682. PMID:18641303
  41. [ + ] Mansour H, et al. (2008) "Intragraft levels of Foxp3 mRNA predict progression in renal transplants with borderline change." J Am Soc Nephrol. 19(12):2277-2281. PMID:18667728
  42. [ + ] Karanikas V, et al. (2008) "Foxp3 expression in human cancer cells." J Transl Med. 6():19. PMID:18430198
  43. [ + ] Basu S, et al. (2008) "Cutting edge: Foxp3-mediated induction of pim 2 allows human T regulatory cells to preferentially expand in rapamycin." J Immunol. 180(9):5794-5798. PMID:18424697
  44. [ + ] Ichiyama K, et al. (2008) "Foxp3 inhibits RORgammat-mediated IL-17A mRNA transcription through direct interaction with RORgammat." J Biol Chem. 283(25):17003-17008. PMID:18434325
  45. [ + ] Vargas-Rojas MI, et al. (2008) "Quantitative and qualitative normal regulatory T cells are not capable of inducing suppression in SLE patients due to T-cell resistance." Lupus. 17(4):289-294. PMID:18413409
  46. [ + ] Aarts-Riemens T, et al. (2008) "Forced overexpression of either of the two common human Foxp3 isoforms can induce regulatory T cells from CD4(+)CD25(-) cells." Eur J Immunol. 38(5):1381-1390. PMID:18412171
  47. [ + ] Chase AJ, et al. (2008) "Preservation of FoxP3+ regulatory T cells in the peripheral blood of human immunodeficiency virus type 1-infected elite suppressors correlates with low CD4+ T-cell activation." J Virol. 82(17):8307-8315. PMID:18579608
  48. [ + ] Ebert LM, et al. (2008) "The regulatory T cell-associated transcription factor FoxP3 is expressed by tumor cells." Cancer Res. 68(8):3001-3009. PMID:18413770
  49. [ + ] Bunnag S, et al. (2008) "FOXP3 expression in human kidney transplant biopsies is associated with rejection and time post transplant but not with favorable outcomes." Am J Transplant. 8(7):1423-1433. PMID:18510637