ABCG8 | GeneID:508829 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 508829 Official Symbol ABCG8
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family G (WHITE), member 8
Chromosome N/A
Also Known As ATP-binding cassette sub-family G member 8; ATP-binding cassette, sub-family G (WHITE), member 8 (sterolin 2)
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 23361

ID Symbol Protein Species
GeneID:64241 ABCG8 NP_071882.1 Homo sapiens
GeneID:67470 Abcg8 NP_080456.1 Mus musculus
GeneID:155192 Abcg8 NP_569098.2 Rattus norvegicus
GeneID:421402 ABCG8 XP_419458.2 Gallus gallus
GeneID:470363 ABCG8 XP_525745.2 Pan troglodytes
GeneID:474571 ABCG8 XP_531799.2 Canis lupus familiaris
GeneID:508829 ABCG8 NP_001019834.1 Bos taurus
GeneID:814660 AT2G01320 NP_178241.1 Arabidopsis thaliana
GeneID:854080 YOL075C NP_014567.1 Saccharomyces cerevisiae
GeneID:2682022 MGG_10410 XP_366191.1 Magnaporthe grisea
GeneID:2892176 KLLA0C04477g XP_452398.1 Kluyveromyces lactis
GeneID:4326045 Os01g0121700 NP_001041878.1 Oryza sativa
GeneID:100136850 abcg8 NP_001108041.1 Danio rerio

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016020 Component membrane
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0042632 Process cholesterol homeostasis
GO:0015914 Process phospholipid transport
GO:0015918 Process sterol transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001024663 NP_001019834

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000021770 MI0005063 bta-miR-122 UGGAGUGUGACAAUGGUGUUUG
ENSBTAT00000021770 MI0005031 bta-miR-17-3p ACUGCAGUGAAGGCACUUGU
ENSBTAT00000021770 MI0004758 bta-miR-199a-3p ACAGUAGUCUGCACAUUGGUUA
ENSBTAT00000021770 MI0005040 bta-miR-214 ACAGCAGGCACAGACAGGCAGU
ENSBTAT00000021770 MI0005464 bta-miR-34a UGGCAGUGUCUUAGCUGGUUGU
ENSBTAT00000021770 MI0005049 bta-miR-455 UAUGUGCCUUUGGACUACAUC
ENSBTAT00000021770 MI0005717 hsa-miR-509-3-5p UACUGCAGACGUGGCAAUCAUG
ENSBTAT00000021770 MI0003196 hsa-miR-509-5p UACUGCAGACAGUGGCAAUCA
ENSBTAT00000021770 MI0005530 hsa-miR-509-5p UACUGCAGACAGUGGCAAUCA
ENSBTAT00000021770 MI0003160 hsa-miR-524-3p GAAGGCGCUUCCCUUUGGAGU
ENSBTAT00000021770 MI0003150 hsa-miR-526b CUCUUGAGGGAAGCACUUUCUGU
ENSBTAT00000021770 MI0003600 hsa-miR-550 AGUGCCUGAGGGAGUAAGAGCCC
ENSBTAT00000021770 MI0003601 hsa-miR-550 AGUGCCUGAGGGAGUAAGAGCCC
ENSBTAT00000021770 MI0003609 hsa-miR-597 UGUGUCACUCGAUGACCACUGU
ENSBTAT00000021770 MI0003636 hsa-miR-622 ACAGUCUGCUGAGGUUGGAGC
ENSBTAT00000021770 MI0003649 hsa-miR-634 AACCAGCACCCCAACUUUGGAC
ENSBTAT00000021770 MI0003654 hsa-miR-639 AUCGCUGCGGUUGCGAGCGCUGU
ENSBTAT00000021770 MI0005762 hsa-miR-940 AAGGCAGGGCCCCCGCUCCCC
ENSBTAT00000021770 MI0000391 mmu-miR-293 AGUGCCGCAGAGUUUGUAGUGU
ENSBTAT00000021770 MI0004553 mmu-miR-666-3p GGCUGCAGCGUGAUCGCCUGCU
ENSBTAT00000021770 MI0004553 mmu-miR-666-5p AGCGGGCACAGCUGUGAGAGCC
ENSBTAT00000021770 MI0004666 mmu-miR-669b AGUUUUGUGUGCAUGUGCAUGU
ENSBTAT00000021770 MI0005003 mmu-miR-676 CCGUCCUGAGGUUGUUGAGCU
ENSBTAT00000021770 MI0004696 mmu-miR-712 CUCCUUCACCCGGGCGGUACC
ENSBTAT00000021770 MI0004306 mmu-miR-761 GCAGCAGGGUGAAACUGACACA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Viturro E, et al. (2006) "Identification, sequence analysis and mRNA tissue distribution of the bovine sterol transporters ABCG5 and ABCG8." J Dairy Sci. 89(2):553-561. PMID:16428624