ABHD2 | GeneID:508717 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 508717 Official Symbol ABHD2
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description abhydrolase domain containing 2
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 23121

ID Symbol Protein Species
GeneID:11057 ABHD2 NP_008942.3 Homo sapiens
GeneID:33532 CG3488 NP_608751.2 Drosophila melanogaster
GeneID:54608 Abhd2 NP_061281.3 Mus musculus
GeneID:293050 Abhd2 XP_214979.2 Rattus norvegicus
GeneID:393888 abhd2a NP_957208.1 Danio rerio
GeneID:415493 ABHD2 XP_413866.2 Gallus gallus
GeneID:467753 ABHD2 XP_523148.2 Pan troglodytes
GeneID:479037 ABHD2 XP_849732.1 Canis lupus familiaris
GeneID:508717 ABHD2 NP_001015549.1 Bos taurus
GeneID:559290 abhd2b NP_001073145.1 Danio rerio
GeneID:1277482 ENSANGG00000004955 XP_316894.2 Anopheles gambiae

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0004091 Function carboxylesterase activity
GO:0016787 Function hydrolase activity
GO:0030336 Process negative regulation of cell migration
GO:0009611 Process response to wounding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001015549 NP_001015549

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000026579 MI0005007 bta-miR-10a UACCCUGUAGAUCCGAAUUUGUG
ENSBTAT00000026579 MI0005052 bta-miR-10b UACCCUGUAGAACCGAAUUUGUG
ENSBTAT00000026579 MI0004754 bta-miR-126 CGUACCGUGAGUAAUAAUGCG
ENSBTAT00000026579 MI0005008 bta-miR-127 UCGGAUCCGUCUGAGCUUGGCU
ENSBTAT00000026579 MI0004738 bta-miR-151 CUAGACUGAAGCUCCUUGAGG
ENSBTAT00000026579 MI0005040 bta-miR-214 ACAGCAGGCACAGACAGGCAGU
ENSBTAT00000026579 MI0005021 bta-miR-380-3p UAUGUAAUGUGGUCCACGUCU
ENSBTAT00000026579 MI0005468 bta-miR-660 UACCCAUUGCAUAUCGGAGCUG
ENSBTAT00000026579 MI0000111 hsa-miR-105 UCAAAUGCUCAGACUCCUGUGGU
ENSBTAT00000026579 MI0000112 hsa-miR-105 UCAAAUGCUCAGACUCCUGUGGU
ENSBTAT00000026579 MI0000448 hsa-miR-130a CAGUGCAAUGUUAAAAGGGCAU
ENSBTAT00000026579 MI0000748 hsa-miR-130b CAGUGCAAUGAUGAAAGGGCAU
ENSBTAT00000026579 MI0000239 hsa-miR-197 UUCACCACCUUCUCCACCCAGC
ENSBTAT00000026579 MI0005529 hsa-miR-220b CCACCACCGUGUCUGACACUU
ENSBTAT00000026579 MI0000086 hsa-miR-28-3p CACUAGAUUGUGAGCUCCUGGA
ENSBTAT00000026579 MI0000807 hsa-miR-323-5p AGGUGGUCCGUGGCGCGUUCGC
ENSBTAT00000026579 MI0000815 hsa-miR-339-3p UGAGCGCCUCGACGACAGAGCCG
ENSBTAT00000026579 MI0003149 hsa-miR-520a-5p CUCCAGAGGGAAGUACUUUCU
ENSBTAT00000026579 MI0003153 hsa-miR-523 GAACGCGCUUCCCUAUAGAGGGU
ENSBTAT00000026579 MI0003152 hsa-miR-525-5p CUCCAGAGGGAUGCACUUUCU
ENSBTAT00000026579 MI0003686 hsa-miR-542-5p UCGGGGAUCAUCAUGUCACGAGA
ENSBTAT00000026579 MI0003593 hsa-miR-548a-3p CAAAACUGGCAAUUACUUUUGC
ENSBTAT00000026579 MI0003598 hsa-miR-548a-3p CAAAACUGGCAAUUACUUUUGC
ENSBTAT00000026579 MI0003612 hsa-miR-548a-3p CAAAACUGGCAAUUACUUUUGC
ENSBTAT00000026579 MI0003596 hsa-miR-548b-3p CAAGAACCUCAGUUGCUUUUGU
ENSBTAT00000026579 MI0003596 hsa-miR-548b-5p AAAAGUAAUUGUGGUUUUGGCC
ENSBTAT00000026579 MI0003630 hsa-miR-548c-5p AAAAGUAAUUGCGGUUUUUGCC
ENSBTAT00000026579 MI0003568 hsa-miR-562 AAAGUAGCUGUACCAUUUGC
ENSBTAT00000026579 MI0003577 hsa-miR-570 CGAAAACAGCAAUUACCUUUGC
ENSBTAT00000026579 MI0003582 hsa-miR-575 GAGCCAGUUGGACAGGAGC
ENSBTAT00000026579 MI0003599 hsa-miR-589 UGAGAACCACGUCUGCUCUGAG
ENSBTAT00000026579 MI0003614 hsa-miR-601 UGGUCUAGGAUUGUUGGAGGAG
ENSBTAT00000026579 MI0003635 hsa-miR-621 GGCUAGCAACAGCGCUUACCU
ENSBTAT00000026579 MI0003642 hsa-miR-628-5p AUGCUGACAUAUUUACUAGAGG
ENSBTAT00000026579 MI0003655 hsa-miR-640 AUGAUCCAGGAACCUGCCUCU
ENSBTAT00000026579 MI0003763 hsa-miR-767-5p UGCACCAUGGUUGUCUGAGCAUG
ENSBTAT00000026579 MI0005713 hsa-miR-921 CUAGUGAGGGACAGAACCAGGAUUC
ENSBTAT00000026579 MI0002401 mmu-miR-466a-5p UAUGUGUGUGUACAUGUACAUA
ENSBTAT00000026579 MI0005502 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENSBTAT00000026579 MI0005503 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENSBTAT00000026579 MI0005504 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENSBTAT00000026579 MI0005505 mmu-miR-466c-5p GAUGUGUGUGUGCAUGUACAUA
ENSBTAT00000026579 MI0005506 mmu-miR-466e-5p GAUGUGUGUGUACAUGUACAUA
ENSBTAT00000026579 MI0003518 mmu-miR-540-3p AGGUCAGAGGUCGAUCCUGG
ENSBTAT00000026579 MI0004654 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENSBTAT00000026579 MI0004655 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENSBTAT00000026579 MI0004699 mmu-miR-714 CGACGAGGGCCGGUCGGUCGC
ENSBTAT00000026579 MI0004708 mmu-miR-721 CAGUGCAAUUAAAAGGGGGAA
ENSBTAT00000026579 MI0005206 mmu-miR-742 GAAAGCCACCAUGCUGGGUAAA
ENSBTAT00000026579 MI0005470 mmu-miR-743b-5p UGUUCAGACUGGUGUCCAUCA
ENSBTAT00000026579 MI0004306 mmu-miR-761 GCAGCAGGGUGAAACUGACACA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Harhay GP, et al. (2005) "Characterization of 954 bovine full-CDS cDNA sequences." BMC Genomics. 6():166. PMID:16305752
  2. [ + ] Smith TP, et al. (2001) "Sequence evaluation of four pooled-tissue normalized bovine cDNA libraries and construction of a gene index for cattle." Genome Res. 11(4):626-630. PMID:11282978