ABCG4 | GeneID:508443 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 508443 Official Symbol ABCG4
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family G (WHITE), member 4
Chromosome N/A
Also Known As ATP-binding cassette, subfamily G, member 4
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 75179

ID Symbol Protein Species
GeneID:64137 ABCG4 NP_071452.2 Homo sapiens
GeneID:173671 wht-4 NP_494495.2 Caenorhabditis elegans
GeneID:192663 Abcg4 NP_620405.3 Mus musculus
GeneID:300664 Abcg4 XP_236186.2 Rattus norvegicus
GeneID:428242 ABCG4 XP_425801.2 Gallus gallus
GeneID:466802 ABCG4 XP_522202.2 Pan troglodytes
GeneID:508443 ABCG4 XP_585219.3 Bos taurus
GeneID:564842 LOC564842 XP_687685.2 Danio rerio
GeneID:610604 ABCG4 XP_853231.1 Canis lupus familiaris
GeneID:794238 abcg4b NP_001104682.1 Danio rerio

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001105343 NP_001098813

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000015667 MI0000288 hsa-miR-212 UAACAGUCUCCAGUCACGGCC
ENSBTAT00000015667 MI0000293 hsa-miR-217 UACUGCAUCAGGAACUGAUUGGA
ENSBTAT00000015667 MI0000296 hsa-miR-219-5p UGAUUGUCCAAACGCAAUUCU
ENSBTAT00000015667 MI0000740 hsa-miR-219-5p UGAUUGUCCAAACGCAAUUCU
ENSBTAT00000015667 MI0000300 hsa-miR-223 UGUCAGUUUGUCAAAUACCCCA
ENSBTAT00000015667 MI0000086 hsa-miR-28-5p AAGGAGCUCACAGUCUAUUGAG
ENSBTAT00000015667 MI0000826 hsa-miR-346 UGUCUGCCCGCAUGCCUGCCUCU
ENSBTAT00000015667 MI0000787 hsa-miR-379 UGGUAGACUAUGGAACGUAGG
ENSBTAT00000015667 MI0001727 hsa-miR-453 AGGUUGUCCGUGGUGAGUUCGCA
ENSBTAT00000015667 MI0003140 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENSBTAT00000015667 MI0003141 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENSBTAT00000015667 MI0003170 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENSBTAT00000015667 MI0003173 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENSBTAT00000015667 MI0003160 hsa-miR-524-3p GAAGGCGCUUCCCUUUGGAGU
ENSBTAT00000015667 MI0003152 hsa-miR-525-3p GAAGGCGCUUCCCUUUAGAGCG
ENSBTAT00000015667 MI0003582 hsa-miR-575 GAGCCAGUUGGACAGGAGC
ENSBTAT00000015667 MI0003655 hsa-miR-640 AUGAUCCAGGAACCUGCCUCU
ENSBTAT00000015667 MI0005116 hsa-miR-765 UGGAGGAGAAGGAAGGUGAUG
ENSBTAT00000015667 MI0005532 hsa-miR-874 CUGCCCUGGCCCGAGGGACCGA
ENSBTAT00000015667 MI0005533 hsa-miR-890 UACUUGGAAAGGCAUCAGUUG
ENSBTAT00000015667 MI0005761 hsa-miR-939 UGGGGAGCUGAGGCUCUGGGGGUG
ENSBTAT00000015667 MI0005510 mmu-miR-466g AUACAGACACAUGCACACACA
ENSBTAT00000015667 MI0004215 mmu-miR-762 GGGGCUGGGGCCGGGACAGAGC
ENSBTAT00000015667 MI0005476 mmu-miR-883a-5p UGCUGAGAGAAGUAGCAGUUAC
ENSBTAT00000015667 MI0000636 rno-miR-349 CAGCCCUGCUGUCUUAACCUCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene