ABCC10 | GeneID:508399 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 508399 Official Symbol ABCC10
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family C (CFTR/MRP), member 10
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 58616

ID Symbol Protein Species
GeneID:34140 CG7806 NP_609207.1 Drosophila melanogaster
GeneID:89845 ABCC10 NP_258261.2 Homo sapiens
GeneID:224814 Abcc10 NP_733780.1 Mus musculus
GeneID:316231 Abcc10 XP_236930.4 Rattus norvegicus
GeneID:421456 ABCC10 XP_419506.2 Gallus gallus
GeneID:462717 ABCC10 XP_518494.2 Pan troglodytes
GeneID:481813 ABCC10 XP_538934.2 Canis lupus familiaris
GeneID:508399 ABCC10 XP_585169.3 Bos taurus
GeneID:815414 ATMRP11 NP_178811.3 Arabidopsis thaliana
GeneID:1278042 AgaP_AGAP007917 XP_317569.2 Anopheles gambiae
GeneID:4340331 Os06g0184700 NP_001056996.1 Oryza sativa

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_585169 XP_585169

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000007685 MI0005057 bta-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSBTAT00000007685 MI0005451 bta-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSBTAT00000007685 MI0005452 bta-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSBTAT00000007685 MI0005453 bta-let-7b UGAGGUAGUAGGUUGUGUGGUU
ENSBTAT00000007685 MI0005454 bta-let-7c UGAGGUAGUAGGUUGUAUGGUU
ENSBTAT00000007685 MI0005026 bta-let-7d AGAGGUAGUAGGUUGCAUAGUU
ENSBTAT00000007685 MI0005455 bta-let-7e UGAGGUAGGAGGUUGUAUAGU
ENSBTAT00000007685 MI0004734 bta-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENSBTAT00000007685 MI0005062 bta-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENSBTAT00000007685 MI0005051 bta-let-7g UGAGGUAGUAGUUUGUACAGUU
ENSBTAT00000007685 MI0005065 bta-let-7i UGAGGUAGUAGUUUGUGCUGUU
ENSBTAT00000007685 MI0005063 bta-miR-122 UGGAGUGUGACAAUGGUGUUUG
ENSBTAT00000007685 MI0004754 bta-miR-126* CAUUAUUACUUUUGGUACGCG
ENSBTAT00000007685 MI0004731 bta-miR-26a UUCAAGUAAUCCAGGAUAGGCU
ENSBTAT00000007685 MI0004745 bta-miR-26b UUCAAGUAAUUCAGGAUAGGUU
ENSBTAT00000007685 MI0005464 bta-miR-34a UGGCAGUGUCUUAGCUGGUUGU
ENSBTAT00000007685 MI0004763 bta-miR-34b AGGCAGUGUAAUUAGCUGAUUG
ENSBTAT00000007685 MI0005045 bta-miR-361 UUAUCAGAAUCUCCAGGGGUAC
ENSBTAT00000007685 MI0001651 cfa-miR-449 UGGCAGUGUAUUGUUAGCUGGU
ENSBTAT00000007685 MI0000437 hsa-miR-1 UGGAAUGUAAAGAAGUAUGUAU
ENSBTAT00000007685 MI0000651 hsa-miR-1 UGGAAUGUAAAGAAGUAUGUAU
ENSBTAT00000007685 MI0003130 hsa-miR-202 AGAGGUAUAGGGCAUGGGAA
ENSBTAT00000007685 MI0000490 hsa-miR-206 UGGAAUGUAAGGAAGUGUGUGG
ENSBTAT00000007685 MI0005570 hsa-miR-208b AUAAGACGAACAAAAGGUUUGU
ENSBTAT00000007685 MI0005536 hsa-miR-220c ACACAGGGCUGUUGUGAAGACU
ENSBTAT00000007685 MI0000301 hsa-miR-224 CAAGUCACUAGUGGUUCCGUU
ENSBTAT00000007685 MI0005775 hsa-miR-297 AUGUAUGUGUGCAUGUGCAUG
ENSBTAT00000007685 MI0000744 hsa-miR-299-3p UAUGUGGGAUGGUAAACCGCUU
ENSBTAT00000007685 MI0000815 hsa-miR-339-3p UGAGCGCCUCGACGACAGAGCCG
ENSBTAT00000007685 MI0000826 hsa-miR-346 UGUCUGCCCGCAUGCCUGCCUCU
ENSBTAT00000007685 MI0003584 hsa-miR-577 UAGAUAAAAUAUUGGUACCUG
ENSBTAT00000007685 MI0003602 hsa-miR-590-3p UAAUUUUAUGUAUAAGCUAGU
ENSBTAT00000007685 MI0003621 hsa-miR-608 AGGGGUGGUGUUGGGACAGCUCCGU
ENSBTAT00000007685 MI0003628 hsa-miR-615-3p UCCGAGCCUGGGUCUCCCUCUU
ENSBTAT00000007685 MI0003628 hsa-miR-615-5p GGGGGUCCCCGGUGCUCGGAUC
ENSBTAT00000007685 MI0003652 hsa-miR-637 ACUGGGGGCUUUCGGGCUCUGCGU
ENSBTAT00000007685 MI0003656 hsa-miR-641 AAAGACAUAGGAUAGAGUCACCUC
ENSBTAT00000007685 MI0003677 hsa-miR-655 AUAAUACAUGGUUAACCUCUUU
ENSBTAT00000007685 MI0003678 hsa-miR-656 AAUAUUAUACAGUCAACCUCU
ENSBTAT00000007685 MI0003669 hsa-miR-661 UGCCUGGGUCUCUGGCCUGCGCGU
ENSBTAT00000007685 MI0003760 hsa-miR-671-5p AGGAAGCCCUGGAGGGGCUGGAG
ENSBTAT00000007685 MI0005116 hsa-miR-765 UGGAGGAGAAGGAAGGUGAUG
ENSBTAT00000007685 MI0000391 mmu-miR-293 AGUGCCGCAGAGUUUGUAGUGU
ENSBTAT00000007685 MI0005504 mmu-miR-466b-3-3p AAUACAUACACGCACACAUAAGA
ENSBTAT00000007685 MI0005505 mmu-miR-466c-5p GAUGUGUGUGUGCAUGUACAUA
ENSBTAT00000007685 MI0005546 mmu-miR-466d-5p UGUGUGUGCGUACAUGUACAUG
ENSBTAT00000007685 MI0005507 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSBTAT00000007685 MI0005508 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSBTAT00000007685 MI0005509 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSBTAT00000007685 MI0005507 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENSBTAT00000007685 MI0005508 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENSBTAT00000007685 MI0005509 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENSBTAT00000007685 MI0004601 mmu-miR-673-3p UCCGGGGCUGAGUUCUGUGCACC
ENSBTAT00000007685 MI0004683 mmu-miR-699 AGGCAGUGCGACCUGGCUCG
ENSBTAT00000007685 MI0004693 mmu-miR-709 GGAGGCAGAGGCAGGAGGA
ENSBTAT00000007685 MI0004554 mmu-miR-759 GCAGAGUGCAAACAAUUUUGAC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_585169  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene