AAAS | GeneID:506561 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 506561 Official Symbol AAAS
Locus N/A Gene Type protein-coding
Synonyms MGC143228
Full Name N/A
Description achalasia, adrenocortical insufficiency, alacrimia (Allgrove, triple-A)
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 9232

ID Symbol Protein Species
GeneID:8086 AAAS NP_056480.1 Homo sapiens
GeneID:31881 CG16892 NP_572557.1 Drosophila melanogaster
GeneID:223921 Aaas NP_700465.1 Mus musculus
GeneID:378454 aaas NP_998390.1 Danio rerio
GeneID:467003 AAAS XP_522403.2 Pan troglodytes
GeneID:506561 AAAS NP_001068737.1 Bos taurus
GeneID:607867 AAAS XP_849797.1 Canis lupus familiaris
GeneID:824857 AT3G56900 NP_191249.2 Arabidopsis thaliana
GeneID:1272488 AgaP_AGAP010685 XP_311401.2 Anopheles gambiae
GeneID:4349688 Os11g0132700 NP_001065665.1 Oryza sativa

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0009566 Process fertilization
GO:0007612 Process learning

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001075269 NP_001068737

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000026878 MI0004753 bta-miR-125b UCCCUGAGACCCUAACUUGUGA
ENSBTAT00000026878 MI0005457 bta-miR-125b UCCCUGAGACCCUAACUUGUGA
ENSBTAT00000026878 MI0005029 bta-miR-138 AGCUGGUGUUGUGAAUCAGGCCG
ENSBTAT00000026878 MI0005014 bta-miR-193a* UGGGUCUUUGCGGGCGAGAUGA
ENSBTAT00000026878 MI0005061 bta-miR-532 CAUGCCUUGAGUGUAGGACCGU
ENSBTAT00000026878 MI0000448 hsa-miR-130a CAGUGCAAUGUUAAAAGGGCAU
ENSBTAT00000026878 MI0000748 hsa-miR-130b CAGUGCAAUGAUGAAAGGGCAU
ENSBTAT00000026878 MI0000475 hsa-miR-136 ACUCCAUUUGUUUUGAUGAUGGA
ENSBTAT00000026878 MI0000086 hsa-miR-28-3p CACUAGAUUGUGAGCUCCUGGA
ENSBTAT00000026878 MI0000745 hsa-miR-301a CAGUGCAAUAGUAUUGUCAAAGC
ENSBTAT00000026878 MI0005568 hsa-miR-301b CAGUGCAAUGAUAUUGUCAAAGC
ENSBTAT00000026878 MI0000813 hsa-miR-324-3p ACUGCCCCAGGUGCUGCUGG
ENSBTAT00000026878 MI0001727 hsa-miR-453 AGGUUGUCCGUGGUGAGUUCGCA
ENSBTAT00000026878 MI0003820 hsa-miR-454 UAGUGCAAUAUUGCUUAUAGGGU
ENSBTAT00000026878 MI0003195 hsa-miR-508-5p UACUCCAGAGGGCGUCACUCAUG
ENSBTAT00000026878 MI0005539 hsa-miR-541 UGGUGGGCACAGAAUCUGGACU
ENSBTAT00000026878 MI0003618 hsa-miR-605 UAAAUCCCAUGGUGCCUUCUCCU
ENSBTAT00000026878 MI0003662 hsa-miR-647 GUGGCUGCACUCACUUCCUUC
ENSBTAT00000026878 MI0003760 hsa-miR-671-3p UCCGGUUCUCAGGGCUCCACC
ENSBTAT00000026878 MI0003763 hsa-miR-767-3p UCUGCUCAUACCCCAUGGUUUCU
ENSBTAT00000026878 MI0005532 hsa-miR-874 CUGCCCUGGCCCGAGGGACCGA
ENSBTAT00000026878 MI0005534 hsa-miR-891b UGCAACUUACCUGAGUCAUUGA
ENSBTAT00000026878 MI0000643 mmu-miR-351 UCCCUGAGGAGCCCUUUGAGCCUG
ENSBTAT00000026878 MI0001526 mmu-miR-434-3p UUUGAACCAUCACUCGACUCCU
ENSBTAT00000026878 MI0004196 mmu-miR-667 UGACACCUGCCACCCAGCCCAAG
ENSBTAT00000026878 MI0004700 mmu-miR-715 CUCCGUGCACACCCCCGCGUG
ENSBTAT00000026878 MI0004708 mmu-miR-721 CAGUGCAAUUAAAAGGGGGAA
ENSBTAT00000026878 MI0005206 mmu-miR-742 GAAAGCCACCAUGCUGGGUAAA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene