ABAT | GeneID:506219 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 506219 Official Symbol ABAT
Locus N/A Gene Type protein-coding
Synonyms GABA-AT; GABA-T; L-AIBAT; MGC137464
Full Name N/A
Description 4-aminobutyrate aminotransferase
Chromosome N/A
Also Known As (S)-3-amino-2-methylpropionate transaminase; GABA aminotransferase; GABA transaminase; Gamma-amino-N-butyrate transaminase
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 542

ID Symbol Protein Species
GeneID:18 ABAT NP_000654.2 Homo sapiens
GeneID:40188 CG7433 NP_649168.2 Drosophila melanogaster
GeneID:81632 Abat NP_112265.1 Rattus norvegicus
GeneID:177897 gta-1 NP_501862.1 Caenorhabditis elegans
GeneID:268860 Abat NP_766549.2 Mus musculus
GeneID:378968 abat NP_958906.1 Danio rerio
GeneID:416642 ABAT XP_414940.2 Gallus gallus
GeneID:453903 ABAT XP_001137090.1 Pan troglodytes
GeneID:479856 ABAT XP_851424.1 Canis lupus familiaris
GeneID:506219 ABAT XP_582638.2 Bos taurus
GeneID:852902 UGA1 NP_011533.1 Saccharomyces cerevisiae
GeneID:1270119 AgaP_AGAP006966 XP_308791.2 Anopheles gambiae
GeneID:2542494 SPAC19D5.07 NP_594905.1 Schizosaccharomyces pombe
GeneID:2679339 MGG_01662 XP_363736.1 Magnaporthe grisea
GeneID:2713300 NCU08998.1 XP_331390.1 Neurospora crassa
GeneID:2895485 KLLA0F20548g XP_456003.1 Kluyveromyces lactis
GeneID:4622915 AGOS_AGL050C NP_986616.1 Eremothecium gossypii

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001081581 NP_001075050

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000005280 MI0005034 bta-miR-191 CAACGGAAUCCCAAAAGCAGCUG
ENSBTAT00000005280 MI0005046 bta-miR-423 AAGCUCGGUCUGAGGCCCCUCAGU
ENSBTAT00000005280 MI0005061 bta-miR-532 CAUGCCUUGAGUGUAGGACCGU
ENSBTAT00000005280 MI0005024 bta-miR-92 UAUUGCACUUGUCCCGGCCUGU
ENSBTAT00000005280 MI0000463 hsa-miR-153 UUGCAUAGUCACAAAAGUGAUC
ENSBTAT00000005280 MI0000464 hsa-miR-153 UUGCAUAGUCACAAAAGUGAUC
ENSBTAT00000005280 MI0000481 hsa-miR-184 UGGACGGAGAACUGAUAAGGGU
ENSBTAT00000005280 MI0000484 hsa-miR-188-3p CUCCCACAUGCAGGGUUUGCA
ENSBTAT00000005280 MI0005569 hsa-miR-216b AAAUCUCUGCAGGCAAAUGUGA
ENSBTAT00000005280 MI0000301 hsa-miR-224 CAAGUCACUAGUGGUUCCGUU
ENSBTAT00000005280 MI0000813 hsa-miR-324-3p ACUGCCCCAGGUGCUGCUGG
ENSBTAT00000005280 MI0000813 hsa-miR-324-5p CGCAUCCCCUAGGGCAUUGGUGU
ENSBTAT00000005280 MI0000814 hsa-miR-338-3p UCCAGCAUCAGUGAUUUUGUUG
ENSBTAT00000005280 MI0003568 hsa-miR-562 AAAGUAGCUGUACCAUUUGC
ENSBTAT00000005280 MI0003577 hsa-miR-570 CGAAAACAGCAAUUACCUUUGC
ENSBTAT00000005280 MI0003581 hsa-miR-574-5p UGAGUGUGUGUGUGUGAGUGUGU
ENSBTAT00000005280 MI0003599 hsa-miR-589 UGAGAACCACGUCUGCUCUGAG
ENSBTAT00000005280 MI0003624 hsa-miR-611 GCGAGGACCCCUCGGGGUCUGAC
ENSBTAT00000005280 MI0003641 hsa-miR-627 GUGAGUCUCUAAGAAAAGAGGA
ENSBTAT00000005280 MI0003649 hsa-miR-634 AACCAGCACCCCAACUUUGGAC
ENSBTAT00000005280 MI0003657 hsa-miR-642 GUCCCUCUCCAAAUGUGUCUUG
ENSBTAT00000005280 MI0003836 hsa-miR-766 ACUCCAGCCCCACAGCCUCAGC
ENSBTAT00000005280 MI0005494 mmu-miR-343 UCUCCCUUCAUGUGCCCAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene