AACS | GeneID:505842 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 505842 Official Symbol AACS
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description acetoacetyl-CoA synthetase
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 11322

ID Symbol Protein Species
GeneID:65984 Aacs NP_075592.1 Rattus norvegicus
GeneID:65985 AACS NP_076417.2 Homo sapiens
GeneID:78894 Aacs NP_084486.1 Mus musculus
GeneID:180992 sur-5 NP_509229.1 Caenorhabditis elegans
GeneID:393984 aacs NP_957303.1 Danio rerio
GeneID:416811 AACS NP_001006184.1 Gallus gallus
GeneID:452361 AACS XP_001135709.1 Pan troglodytes
GeneID:486240 AACS XP_543365.2 Canis lupus familiaris
GeneID:505842 AACS XP_582199.3 Bos taurus
GeneID:2675470 MGG_05196 XP_359581.2 Magnaporthe grisea
GeneID:2704372 NCU00446.1 XP_322532.1 Neurospora crassa

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_582199 XP_582199

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000007459 MI0005014 bta-miR-193a AACUGGCCUACAAAGUCCCAGU
ENSBTAT00000007459 MI0005460 bta-miR-19a UGUGCAAAUCUAUGCAAAACUGA
ENSBTAT00000007459 MI0005461 bta-miR-19b UGUGCAAAUCCAUGCAAAACUGA
ENSBTAT00000007459 MI0004731 bta-miR-26a UUCAAGUAAUCCAGGAUAGGCU
ENSBTAT00000007459 MI0005463 bta-miR-331 GCCCCUGGGCCUAUCCUAGAA
ENSBTAT00000007459 MI0005059 bta-miR-342 UCUCACACAGAAAUCGCACCCAUCU
ENSBTAT00000007459 MI0005047 bta-miR-425-3p AUCGGGAAUGUCGUGUCCGCCC
ENSBTAT00000007459 MI0005047 bta-miR-425-5p AUGACACGAUCACUCCCGUUGA
ENSBTAT00000007459 MI0005056 bta-miR-7 UGGAAGACUAGUGAUUUUGUUGUU
ENSBTAT00000007459 MI0004751 bta-miR-99a AACCCGUAGAUCCGAUCUUGU
ENSBTAT00000007459 MI0005469 bta-miR-99b CACCCGUAGAACCGACCUUGCG
ENSBTAT00000007459 MI0000437 hsa-miR-1 UGGAAUGUAAAGAAGUAUGUAU
ENSBTAT00000007459 MI0000651 hsa-miR-1 UGGAAUGUAAAGAAGUAUGUAU
ENSBTAT00000007459 MI0000102 hsa-miR-100 AACCCGUAGAUCCGAACUUGUG
ENSBTAT00000007459 MI0005544 hsa-miR-147b GUGUGCGGAAAUGCUUCUGCUA
ENSBTAT00000007459 MI0000480 hsa-miR-154 UAGGUUAUCCGUGUUGCCUUCG
ENSBTAT00000007459 MI0000273 hsa-miR-183 UAUGGCACUGGUAGAAUUCACU
ENSBTAT00000007459 MI0000481 hsa-miR-184 UGGACGGAGAACUGAUAAGGGU
ENSBTAT00000007459 MI0000484 hsa-miR-188-3p CUCCCACAUGCAGGGUUUGCA
ENSBTAT00000007459 MI0000490 hsa-miR-206 UGGAAUGUAAGGAAGUGUGUGG
ENSBTAT00000007459 MI0000296 hsa-miR-219-1-3p AGAGUUGAGUCUGGACGUCCCG
ENSBTAT00000007459 MI0005525 hsa-miR-300 UAUACAAGGGCAGACUCUCUCU
ENSBTAT00000007459 MI0001725 hsa-miR-329 AACACACCUGGUUAACCUCUUU
ENSBTAT00000007459 MI0001726 hsa-miR-329 AACACACCUGGUUAACCUCUUU
ENSBTAT00000007459 MI0000803 hsa-miR-330-5p UCUCUGGGCCUGUGUCUUAGGC
ENSBTAT00000007459 MI0000762 hsa-miR-362-3p AACACACCUAUUCAAGGAUUCA
ENSBTAT00000007459 MI0000787 hsa-miR-379 UGGUAGACUAUGGAACGUAGG
ENSBTAT00000007459 MI0001735 hsa-miR-409-5p AGGUUACCCGAGCAACUUUGCAU
ENSBTAT00000007459 MI0001727 hsa-miR-453 AGGUUGUCCGUGGUGAGUUCGCA
ENSBTAT00000007459 MI0003131 hsa-miR-492 AGGACCUGCGGGACAAGAUUCUU
ENSBTAT00000007459 MI0003132 hsa-miR-493 UGAAGGUCUACUGUGUGCCAGG
ENSBTAT00000007459 MI0003180 hsa-miR-516a-3p UGCUUCCUUUCAGAGGGU
ENSBTAT00000007459 MI0003181 hsa-miR-516a-3p UGCUUCCUUUCAGAGGGU
ENSBTAT00000007459 MI0003170 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENSBTAT00000007459 MI0003173 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENSBTAT00000007459 MI0003149 hsa-miR-520a-5p CUCCAGAGGGAAGUACUUUCU
ENSBTAT00000007459 MI0003160 hsa-miR-524-3p GAAGGCGCUUCCCUUUGGAGU
ENSBTAT00000007459 MI0003160 hsa-miR-524-5p CUACAAAGGGAAGCACUUUCUC
ENSBTAT00000007459 MI0003152 hsa-miR-525-3p GAAGGCGCUUCCCUUUAGAGCG
ENSBTAT00000007459 MI0003152 hsa-miR-525-5p CUCCAGAGGGAUGCACUUUCU
ENSBTAT00000007459 MI0003569 hsa-miR-563 AGGUUGACAUACGUUUCCC
ENSBTAT00000007459 MI0003574 hsa-miR-568 AUGUAUAAAUGUAUACACAC
ENSBTAT00000007459 MI0003582 hsa-miR-575 GAGCCAGUUGGACAGGAGC
ENSBTAT00000007459 MI0003591 hsa-miR-584 UUAUGGUUUGCCUGGGACUGAG
ENSBTAT00000007459 MI0003592 hsa-miR-585 UGGGCGUAUCUGUAUGCUA
ENSBTAT00000007459 MI0003607 hsa-miR-595 GAAGUGUGCCGUGGUGUGUCU
ENSBTAT00000007459 MI0003615 hsa-miR-602 GACACGGGCGACAGCUGCGGCCC
ENSBTAT00000007459 MI0003639 hsa-miR-625 AGGGGGAAAGUUCUAUAGUCC
ENSBTAT00000007459 MI0003650 hsa-miR-635 ACUUGGGCACUGAAACAAUGUCC
ENSBTAT00000007459 MI0003663 hsa-miR-648 AAGUGUGCAGGGCACUGGU
ENSBTAT00000007459 MI0003667 hsa-miR-652 AAUGGCGCCACUAGGGUUGUG
ENSBTAT00000007459 MI0003669 hsa-miR-661 UGCCUGGGUCUCUGGCCUGCGCGU
ENSBTAT00000007459 MI0005532 hsa-miR-874 CUGCCCUGGCCCGAGGGACCGA
ENSBTAT00000007459 MI0005527 hsa-miR-886-3p CGCGGGUGCUUACUGACCCUU
ENSBTAT00000007459 MI0002637 mml-miR-189 GUGCCUACUGAGCUGAUAUCAGU
ENSBTAT00000007459 MI0000390 mmu-miR-292-3p AAAGUGCCGCCAGGUUUUGAGUGU
ENSBTAT00000007459 MI0001526 mmu-miR-434-3p UUUGAACCAUCACUCGACUCCU
ENSBTAT00000007459 MI0005507 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSBTAT00000007459 MI0005508 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSBTAT00000007459 MI0005509 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSBTAT00000007459 MI0004295 mmu-miR-670 AUCCCUGAGUGUAUGUGGUGAA
ENSBTAT00000007459 MI0004640 mmu-miR-680 GGGCAUCUGCUGACAUGGGGG
ENSBTAT00000007459 MI0004641 mmu-miR-680 GGGCAUCUGCUGACAUGGGGG
ENSBTAT00000007459 MI0004642 mmu-miR-680 GGGCAUCUGCUGACAUGGGGG
ENSBTAT00000007459 MI0004684 mmu-miR-700 CACGCGGGAACCGAGUCCACC
ENSBTAT00000007459 MI0004688 mmu-miR-704 AGACAUGUGCUCUGCUCCUAG
ENSBTAT00000007459 MI0004695 mmu-miR-711 GGGACCCGGGGAGAGAUGUAAG
ENSBTAT00000007459 MI0005470 mmu-miR-743b-3p GAAAGACAUCAUGCUGAAUAGA
ENSBTAT00000007459 MI0004310 mmu-miR-764-5p GGUGCUCACAUGUCCUCCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Harhay GP, et al. (2005) "Characterization of 954 bovine full-CDS cDNA sequences." BMC Genomics. 6():166. PMID:16305752
  2. [ + ] Smith TP, et al. (2001) "Sequence evaluation of four pooled-tissue normalized bovine cDNA libraries and construction of a gene index for cattle." Genome Res. 11(4):626-630. PMID:11282978