ABCA3 | GeneID:505787 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 505787 Official Symbol ABCA3
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family A (ABC1), member 3
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 37437

ID Symbol Protein Species
GeneID:21 ABCA3 NP_001080.2 Homo sapiens
GeneID:27410 Abca3 NP_001034670.1 Mus musculus
GeneID:33103 CG1718 NP_608445.1 Drosophila melanogaster
GeneID:178559 abt-4 NP_503175.1 Caenorhabditis elegans
GeneID:302973 Abca3 XP_220219.4 Rattus norvegicus
GeneID:416386 ABCA3 XP_414701.2 Gallus gallus
GeneID:453833 ABCA3 XP_510744.2 Pan troglodytes
GeneID:479879 ABCA3 XP_537004.2 Canis lupus familiaris
GeneID:505787 ABCA3 XP_582132.3 Bos taurus
GeneID:1269722 AgaP_AGAP007504 XP_308371.2 Anopheles gambiae
GeneID:1276992 AgaP_AGAP006379 XP_557048.1 Anopheles gambiae
GeneID:1280527 AgaP_AGAP012156 XP_552044.1 Anopheles gambiae

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001113746 NP_001107218
2 XM_001790203 XP_001790255

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000019840 MI0004743 bta-miR-221 AGCUACAUUGUCUGCUGGGUUU
ENSBTAT00000019840 MI0004744 bta-miR-222 AGCUACAUCUGGCUACUGGGU
ENSBTAT00000019840 MI0005049 bta-miR-455 UAUGUGCCUUUGGACUACAUC
ENSBTAT00000019840 MI0000086 hsa-miR-28-5p AAGGAGCUCACAGUCUAUUGAG
ENSBTAT00000019840 MI0000807 hsa-miR-323-5p AGGUGGUCCGUGGCGCGUUCGC
ENSBTAT00000019840 MI0000813 hsa-miR-324-3p ACUGCCCCAGGUGCUGCUGG
ENSBTAT00000019840 MI0001725 hsa-miR-329 AACACACCUGGUUAACCUCUUU
ENSBTAT00000019840 MI0001726 hsa-miR-329 AACACACCUGGUUAACCUCUUU
ENSBTAT00000019840 MI0000762 hsa-miR-362-3p AACACACCUAUUCAAGGAUUCA
ENSBTAT00000019840 MI0000791 hsa-miR-383 AGAUCAGAAGGUGAUUGUGGCU
ENSBTAT00000019840 MI0003654 hsa-miR-639 AUCGCUGCGGUUGCGAGCGCUGU
ENSBTAT00000019840 MI0003655 hsa-miR-640 AUGAUCCAGGAACCUGCCUCU
ENSBTAT00000019840 MI0003682 hsa-miR-658 GGCGGAGGGAAGUAGGUCCGUUGGU
ENSBTAT00000019840 MI0004635 mmu-miR-678 GUCUCGGUGCAAGGACUGGAGG
ENSBTAT00000019840 MI0004682 mmu-miR-698 CAUUCUCGUUUCCUUCCCU
ENSBTAT00000019840 MI0004651 mmu-miR-719 AUCUCGGCUACAGAAAAAUGUU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene