Aak1 | GeneID:500244 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 500244 Official Symbol Aak1
Locus N/A Gene Type protein-coding
Synonyms RGD1563580
Full Name AP2 associated kinase 1
Description AP2 associated kinase 1
Chromosome 4q34
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 75032

ID Symbol Protein Species
GeneID:22848 AAK1 NP_055726.3 Homo sapiens
GeneID:269774 Aak1 NP_001035195.1 Mus musculus
GeneID:419512 AAK1 XP_417663.2 Gallus gallus
GeneID:474625 AAK1 XP_531855.2 Canis lupus familiaris
GeneID:500244 Aak1 XP_575594.2 Rattus norvegicus
GeneID:532546 AAK1 XP_611658.3 Bos taurus
GeneID:736127 AAK1 XP_001138098.1 Pan troglodytes
GeneID:817846 AT2G32850 NP_565756.1 Arabidopsis thaliana
GeneID:4346601 Os09g0279100 NP_001062756.1 Oryza sativa

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab66005 AAK1 antibody (ab66005); Rabbit polyclonal to AAK1
2 abcam ab59740 AAK1 antibody (ab59740); Rabbit polyclonal to AAK1

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005905 Component coated pit
GO:0005886 Component plasma membrane
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0004674 Function protein serine/threonine kinase activity
GO:0016740 Function transferase activity
GO:0006468 Process protein amino acid phosphorylation

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_001070331  UCSC Browser XP_001070331
2 XM_575594  UCSC Browser XP_575594

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000043082 MI0003642 hsa-miR-628-3p UCUAGUAAGAGUGGCAGUCGA
ENSRNOT00000043082 MI0003647 hsa-miR-632 GUGUCUGCUUCCUGUGGGA
ENSRNOT00000043082 MI0003682 hsa-miR-658 GGCGGAGGGAAGUAGGUCCGUUGGU
ENSRNOT00000043082 MI0003683 hsa-miR-659 CUUGGUUCAGGGAGGGUCCCCA
ENSRNOT00000043082 MI0000177 mmu-miR-155 UUAAUGCUAAUUGUGAUAGGGGU
ENSRNOT00000043082 MI0006127 mmu-miR-582-3p CCUGUUGAACAACUGAACCCAA
ENSRNOT00000043082 MI0004634 mmu-miR-677 UUCAGUGAUGAUUAGCUUCUGA
ENSRNOT00000043082 MI0004644 mmu-miR-682 CUGCAGUCACAGUGAAGUCUG
ENSRNOT00000043082 MI0004690 mmu-miR-706 AGAGAAACCCUGUCUCAAAAAA
ENSRNOT00000043082 MI0000925 rno-miR-181a AACAUUCAACGCUGUCGGUGAGU
ENSRNOT00000043082 MI0000953 rno-miR-181a AACAUUCAACGCUGUCGGUGAGU
ENSRNOT00000043082 MI0000926 rno-miR-181b AACAUUCAUUGCUGUCGGUGGGU
ENSRNOT00000043082 MI0000927 rno-miR-181b AACAUUCAUUGCUGUCGGUGGGU
ENSRNOT00000043082 MI0000924 rno-miR-181c AACAUUCAACCUGUCGGUGAGU
ENSRNOT00000043082 MI0006132 rno-miR-181d AACAUUCAUUGUUGUCGGUGGGU
ENSRNOT00000043082 MI0006134 rno-miR-188 CAUCCCUUGCAUGGUGGAGGG
ENSRNOT00000043082 MI0000960 rno-miR-219-2-3p AGAAUUGUGGCUGGACAUCUGU
ENSRNOT00000043082 MI0000620 rno-miR-339-5p UCCCUGUCCUCCAGGAGCUCACG
ENSRNOT00000043082 MI0006142 rno-miR-384-3p AUUCCUAGAAAUUGUUCACAAU
ENSRNOT00000043082 MI0006151 rno-miR-484 UCAGGCUCAGUCCCCUCCCGAU
ENSRNOT00000043082 MI0006118 rno-miR-874 CUGCCCUGGCCCGAGGGACCGA
ENSRNOT00000043082 MI0006126 rno-miR-883 UAACUGCAACAUCUCUCAGUAU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Gibbs RA, et al. (2004) "Genome sequence of the Brown Norway rat yields insights into mammalian evolution." Nature. 428(6982):493-521. PMID:15057822
  2. [ + ] Conner SD, et al. (2003) "AAK1-mediated micro2 phosphorylation is stimulated by assembled clathrin." Traffic. 4(12):885-890. PMID:14617351
  3. [ + ] Conner SD, et al. (2002) "Identification of an adaptor-associated kinase, AAK1, as a regulator of clathrin-mediated endocytosis." J Cell Biol. 156(5):921-929. PMID:11877461