ACO2 | GeneID:50 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 50 Official Symbol ACO2
Locus N/A Gene Type protein-coding
Synonyms ACONM; MGC20605; MGC33908
Full Name aconitase 2, mitochondrial
Description aconitase 2, mitochondrial
Chromosome 22q11.2-q13.31|22q13.2
Also Known As OTTHUMP00000042146; OTTHUMP00000165920; aconitate hydratase; citrate hydro-lyase
Summary The protein encoded by this gene belongs to the aconitase/IPM isomerase family. It is an enzyme that catalyzes the interconversion of citrate to isocitrate via cis-aconitate in the second step of the TCA cycle. This protein is encoded in the nucleus and functions in the mitochondrion. It was found to be one of the mitochondrial matrix proteins that are preferentially degraded by the serine protease 15(PRSS15), also known as Lon protease, after oxidative modification. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 856

ID Symbol Protein Species
GeneID:50 ACO2 NP_001089.1 Homo sapiens
GeneID:11429 Aco2 NP_542364.1 Mus musculus
GeneID:44149 Acon NP_524708.1 Drosophila melanogaster
GeneID:79250 Aco2 NP_077374.2 Rattus norvegicus
GeneID:176121 aco-2 NP_741235.1 Caenorhabditis elegans
GeneID:280976 ACO2 NP_776402.1 Bos taurus
GeneID:322670 aco2 NP_944590.1 Danio rerio
GeneID:374009 ACO2 NP_989519.1 Gallus gallus
GeneID:470193 ACO2 XP_001141262.1 Pan troglodytes
GeneID:474487 ACO2 XP_858303.1 Canis lupus familiaris
GeneID:851013 ACO1 NP_013407.1 Saccharomyces cerevisiae
GeneID:1278105 AgaP_AGAP007852 XP_317642.2 Anopheles gambiae
GeneID:2541450 SPAC24C9.06c NP_594031.1 Schizosaccharomyces pombe
GeneID:2676822 MGG_03521 XP_360978.1 Magnaporthe grisea
GeneID:2713053 NCU02366.1 XP_331142.1 Neurospora crassa
GeneID:2891900 KLLA0C17314g XP_452974.1 Kluyveromyces lactis
GeneID:4620213 AGOS_ADL032W NP_984065.1 Eremothecium gossypii

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab72374 Aconitase 2 antibody (ab72374); Rabbit polyclonal to Aconitase 2
2 abcam ab71452 Aconitase 2 antibody - Carboxyterminal end (ab71452); Rabbit polyclonal to Aconitase 2 - Carboxyterminal end
3 abcam ab71439 Aconitase 2 antibody (ab71439); Rabbit polyclonal to Aconitase 2
4 abgent AP7561d ACO2 Antibody (C-term); Purified Rabbit Polyclonal Antibody (Pab)
5 abgent AP1936c ACO2 Antibody (Center); Purified Rabbit Polyclonal Antibody (Pab)
6 abgent AP7561c ACO2 Antibody (Center); Purified Rabbit Polyclonal Antibody (Pab)
7 abgent AP1936a ACO2 Antibody (N-term); Purified Rabbit Polyclonal Antibody (Pab)
8 abgent AP7561b ACO2 Antibody (C-term); Purified Rabbit Polyclonal Antibody (Pab)
9 abnova H00000050-M01 ACO2 monoclonal antibody (M01), clone 1A11; Mouse monoclonal antibody raised against a partial recombinant ACO2.
10 acris AP14203PU-N ACO2 (C-term); antibody Ab
11 acris AP11744PU-N ACO2 (N-term); antibody Ab
12 acris AP14204PU-N ACO2 (Center); antibody Ab
13 acris AP11745PU-N ACO2 (Center); antibody Ab
14 acris AP14205PU-N ACO2 (C-term); antibody Ab
15 sigma HPA001097 Anti-ACO2 antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of ACO2 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ACO2 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005759 Component mitochondrial matrix
GO:0005739 Component mitochondrion
GO:0005634 Component nucleus
GO:0051539 Function 4 iron, 4 sulfur cluster binding
GO:0003994 Function aconitate hydratase activity
GO:0005506 Function iron ion binding
GO:0016829 Function lyase activity
GO:0046872 Function metal ion binding
GO:0006101 Process citrate metabolic process
GO:0006091 Process generation of precursor metabolites and energy
GO:0008152 Process metabolic process
GO:0006099 Process tricarboxylic acid cycle

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001098  UCSC Browser NP_001089

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000216254 MI0000472 hsa-miR-127-3p UCGGAUCCGUCUGAGCUUGGCU
ENST00000216254 MI0000456 hsa-miR-140-3p UACCACAGGGUAGAACCACGG
ENST00000216254 MI0000262 hsa-miR-147 GUGUGUGGAAAUGCUUCUGC
ENST00000216254 MI0000269 hsa-miR-181a-2* ACCACUGACCGUUGACUGUACC
ENST00000216254 MI0000273 hsa-miR-183 UAUGGCACUGGUAGAAUUCACU
ENST00000216254 MI0000481 hsa-miR-184 UGGACGGAGAACUGAUAAGGGU
ENST00000216254 MI0000487 hsa-miR-193a-5p UGGGUCUUUGCGGGCGAGAUGA
ENST00000216254 MI0000283 hsa-miR-203 GUGAAAUGUUUAGGACCACUAG
ENST00000216254 MI0000288 hsa-miR-212 UAACAGUCUCCAGUCACGGCC
ENST00000216254 MI0000296 hsa-miR-219-1-3p AGAGUUGAGUCUGGACGUCCCG
ENST00000216254 MI0000078 hsa-miR-22 AAGCUGCCAGUUGAAGAACUGU
ENST00000216254 MI0000085 hsa-miR-27a UUCACAGUGGCUAAGUUCCGC
ENST00000216254 MI0000440 hsa-miR-27b UUCACAGUGGCUAAGUUCUGC
ENST00000216254 MI0000747 hsa-miR-296-5p AGGGCCCCCCCUCAAUCCUGU
ENST00000216254 MI0000105 hsa-miR-29b-1* GCUGGUUUCAUAUGGUGGUUUAGA
ENST00000216254 MI0000816 hsa-miR-335 UCAAGAGCAAUAACGAAAAAUGU
ENST00000216254 MI0000779 hsa-miR-371-5p ACUCAAACUGUGGGGGCACU
ENST00000216254 MI0000781 hsa-miR-373* ACUCAAAAUGGGGGCGCUUUCC
ENST00000216254 MI0000786 hsa-miR-378 ACUGGACUUGGAGUCAGAAGG
ENST00000216254 MI0001444 hsa-miR-422a ACUGGACUUAGGGUCAGAAGGC
ENST00000216254 MI0003133 hsa-miR-432 UCUUGGAGUAGGUCAUUGGGUGG
ENST00000216254 MI0003133 hsa-miR-432* CUGGAUGGCUCCUCCAUGUCU
ENST00000216254 MI0002467 hsa-miR-483-5p AAGACGGGAGGAAAGAAGGGAG
ENST00000216254 MI0003184 hsa-miR-500 UAAUCCUUGCUACCUGGGUGAGA
ENST00000216254 MI0003185 hsa-miR-501-5p AAUCCUUUGUCCCUGGGUGAGA
ENST00000216254 MI0003186 hsa-miR-502-5p AUCCUUGCUAUCUGGGUGCUA
ENST00000216254 MI0003161 hsa-miR-517* CCUCUAGAUGGAAGCACUGUCU
ENST00000216254 MI0003165 hsa-miR-517* CCUCUAGAUGGAAGCACUGUCU
ENST00000216254 MI0003174 hsa-miR-517* CCUCUAGAUGGAAGCACUGUCU
ENST00000216254 MI0003612 hsa-miR-548a-5p AAAAGUAAUUGCGAGUUUUACC
ENST00000216254 MI0003596 hsa-miR-548b-3p CAAGAACCUCAGUUGCUUUUGU
ENST00000216254 MI0003596 hsa-miR-548b-5p AAAAGUAAUUGUGGUUUUGGCC
ENST00000216254 MI0003630 hsa-miR-548c-5p AAAAGUAAUUGCGGUUUUUGCC
ENST00000216254 MI0003668 hsa-miR-548d-5p AAAAGUAAUUGUGGUUUUUGCC
ENST00000216254 MI0003671 hsa-miR-548d-5p AAAAGUAAUUGUGGUUUUUGCC
ENST00000216254 MI0003564 hsa-miR-558 UGAGCUGCUGUACCAAAAU
ENST00000216254 MI0003565 hsa-miR-559 UAAAGUAAAUAUGCACCAAAA
ENST00000216254 MI0003589 hsa-miR-582-5p UUACAGUUGUUCAACCAGUUACU
ENST00000216254 MI0003591 hsa-miR-584 UUAUGGUUUGCCUGGGACUGAG
ENST00000216254 MI0003599 hsa-miR-589 UGAGAACCACGUCUGCUCUGAG
ENST00000216254 MI0003599 hsa-miR-589* UCAGAACAAAUGCCGGUUCCCAGA
ENST00000216254 MI0003623 hsa-miR-610 UGAGCUAAAUGUGUGCUGGGA
ENST00000216254 MI0003629 hsa-miR-616* ACUCAAAACCCUUCAGUGACUU
ENST00000216254 MI0003665 hsa-miR-650 AGGAGGCAGCGCUCUCAGGAC
ENST00000216254 MI0003667 hsa-miR-652 AAUGGCGCCACUAGGGUUGUG
ENST00000216254 MI0003676 hsa-miR-654-3p UAUGUCUGCUGACCAUCACCUU
ENST00000216254 MI0003672 hsa-miR-663 AGGCGGGGCGCCGCGGGACCGC
ENST00000216254 MI0003761 hsa-miR-668 UGUCACUCGGCUCGGCCCACUAC
ENST00000216254 MI0003760 hsa-miR-671-5p AGGAAGCCCUGGAGGGGCUGGAG
ENST00000216254 MI0005559 hsa-miR-744 UGCGGGGCUAGGGCUAACAGCA
ENST00000216254 MI0005564 hsa-miR-873 GCAGGAACUUGUGAGUCUCCU
ENST00000216254 MI0005527 hsa-miR-886-5p CGGGUCGGAGUUAGCUCAAGCGG
ENST00000216254 MI0005537 hsa-miR-888 UACUCAAAAAGCUGUCAGUCA
ENST00000216254 MI0005715 hsa-miR-923 GUCAGCGGAGGAAAAGAAACU
ENST00000216254 MI0005716 hsa-miR-924 AGAGUCUUGUGAUGUCUUGC
ENST00000216254 MI0000094 hsa-miR-92a-2* GGGUGGGGAUUUGUUGCAUUAC
ENST00000216254 MI0003560 hsa-miR-92b* AGGGACGGGACGCGGUGCAGUG
ENST00000216254 MI0005757 hsa-miR-935 CCAGUUACCGCUUCCGCUACCGC
ENST00000216254 MI0005761 hsa-miR-939 UGGGGAGCUGAGGCUCUGGGGGUG
ENST00000216254 MI0000388 mmu-miR-290-5p ACUCAAACUAUGGGGGCACUUU
ENST00000216254 MI0000389 mmu-miR-291a-5p CAUCAAAGUGGAGGCCCUCUCU
ENST00000216254 MI0001526 mmu-miR-434-3p UUUGAACCAUCACUCGACUCCU
ENST00000216254 MI0002405 mmu-miR-470 UUCUUGGACUGGCACUGGUGAGU
ENST00000216254 MI0003517 mmu-miR-546 AUGGUGGCACGGAGUC
ENST00000216254 MI0004673 mmu-miR-669c AUAGUUGUGUGUGGAUGUGUGU
ENST00000216254 MI0004647 mmu-miR-684 AGUUUUCCCUUCAAGUCAA
ENST00000216254 MI0004648 mmu-miR-684 AGUUUUCCCUUCAAGUCAA
ENST00000216254 MI0004685 mmu-miR-701 UUAGCCGCUGAAAUAGAUGGA
ENST00000216254 MI0004696 mmu-miR-712 CUCCUUCACCCGGGCGGUACC
ENST00000216254 MI0004698 mmu-miR-713 UGCACUGAAGGCACACAGC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

[ - ] Somatic Mutations in Cancer - Sanger's COSMIC

The mutation data was obtained from the Sanger Institute Catalogue Of Somatic Mutations In Cancer web site, http://www.sanger.ac.uk/cosmic Bamford et al (2004) The COSMIC (Catalogue of Somatic Mutations in Cancer) database and website. Br J Cancer, 91,355-358.
Mutation (top 10)Total Observations
c.1528G>C1
c.1508G>A1
Primary Site / Histology (Top 10)Mutations (sites * observations)
lung / carcinoma1
breast / carcinoma1

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
1-Methyl-4-phenylpyridinium
  • 1-Methyl-4-phenylpyridinium results in decreased activity of ACO2 protein
11520895
6-Cyano-7-nitroquinoxaline-2,3-dione
  • 6-Cyano-7-nitroquinoxaline-2,3-dione inhibits the reaction [Kainic Acid results in decreased activity of ACO2 protein]
11520895
Aluminum
  • Aluminum promotes the reaction [Nitroprusside results in decreased activity of ACO2 protein]
  • Aluminum results in decreased activity of ACO2 protein
12470706
Aluminum
  • Aluminum results in decreased expression of and results in decreased activity of ACO2 protein
16906525
Cadmium
  • Cadmium results in decreased activity of ACO2 protein
17170147
Citric Acid
  • [Citric Acid co-treated with zinc chloride] results in decreased activity of ACO2 protein
16624386
Deferoxamine
  • Deferoxamine results in decreased expression of ACO2 protein
17469137, 16568477
Doxorubicin
  • Doxorubicin results in decreased activity of ACO2 protein
15792986
Doxorubicin
  • Doxorubicin results in decreased expression of ACO2 protein
16144979
ferric ammonium citrate
  • ferric ammonium citrate inhibits the reaction [Manganese results in decreased activity of ACO2 protein]
  • ferric ammonium citrate inhibits the reaction [manganese chloride results in decreased activity of ACO2 protein]
  • ferric ammonium citrate results in increased activity of ACO2 protein
16625280
Glucose
  • [Glucose co-treated with Oxygen] affects the activity of ACO2 protein
  • manganese tetrakis-(N-ethyl-2 pyridyl) porphyrin inhibits the reaction [[Glucose co-treated with Oxygen] affects the activity of ACO2 protein]
  • manganese(III)-tetrakis(4-benzoic acid)porphyrin inhibits the reaction [[Glucose co-treated with Oxygen] affects the activity of ACO2 protein]
11520895
Hemin
  • Hemin results in increased expression of ACO2 protein
16568477
Kainic Acid
  • 6-Cyano-7-nitroquinoxaline-2,3-dione inhibits the reaction [Kainic Acid results in decreased activity of ACO2 protein]
  • Kainic Acid results in decreased activity of ACO2 protein
  • manganese(III)-tetrakis(4-benzoic acid)porphyrin inhibits the reaction [Kainic Acid results in decreased activity of ACO2 protein]
11520895
Lindane
  • Lindane results in increased expression of ACO2 mRNA
17785943
Manganese
  • Manganese results in decreased activity of ACO2 protein
  • Manganese results in decreased expression of ACO2 mRNA
  • Manganese results in decreased expression of ACO2 protein
  • ferric ammonium citrate inhibits the reaction [Manganese results in decreased activity of ACO2 protein]
16625280
Manganese
  • Manganese results in decreased activity of ACO2 protein
17469137
manganese chloride
  • ferric ammonium citrate inhibits the reaction [manganese chloride results in decreased activity of ACO2 protein]
  • manganese chloride results in decreased activity of ACO2 protein
  • manganese chloride results in decreased expression of ACO2 mRNA
  • manganese chloride results in decreased expression of ACO2 protein
16625280
manganese(III)-tetrakis(4-benzoic acid)porphyrin
  • manganese(III)-tetrakis(4-benzoic acid)porphyrin inhibits the reaction [Kainic Acid results in decreased activity of ACO2 protein]
  • manganese(III)-tetrakis(4-benzoic acid)porphyrin inhibits the reaction [[Glucose co-treated with Oxygen] affects the activity of ACO2 protein]
11520895
manganese tetrakis-(N-ethyl-2 pyridyl) porphyrin
  • manganese tetrakis-(N-ethyl-2 pyridyl) porphyrin inhibits the reaction [[Glucose co-treated with Oxygen] affects the activity of ACO2 protein]
11520895
nickel chloride
  • nickel chloride results in decreased activity of ACO2 protein
17018869
Nitroprusside
  • Aluminum promotes the reaction [Nitroprusside results in decreased activity of ACO2 protein]
  • Nitroprusside results in decreased activity of ACO2 protein
12470706
Oxygen
  • [Glucose co-treated with Oxygen] affects the activity of ACO2 protein
  • manganese tetrakis-(N-ethyl-2 pyridyl) porphyrin inhibits the reaction [[Glucose co-treated with Oxygen] affects the activity of ACO2 protein]
  • manganese(III)-tetrakis(4-benzoic acid)porphyrin inhibits the reaction [[Glucose co-treated with Oxygen] affects the activity of ACO2 protein]
11520895
Paraquat
  • Paraquat results in decreased activity of ACO2 protein
  • SNCA protein inhibits the reaction [Paraquat results in decreased activity of ACO2 protein]
15234109
Paraquat
  • Paraquat results in decreased activity of ACO2 protein
11520895
perfluorooctanoic acid
  • perfluorooctanoic acid results in increased expression of ACO2 mRNA
16221955
pirinixic acid
  • pirinixic acid results in increased expression of ACO2 mRNA
18301758
Rotenone
  • Rotenone results in decreased activity of ACO2 protein
11520895
Zinc
  • Zinc binds to ACO2 protein
15913554
zinc chloride
  • [Citric Acid co-treated with zinc chloride] results in decreased activity of ACO2 protein
16624386

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Acrodermatitis inferred via Zinc 17190629, 17202136, 16889938
Alzheimer Disease inferred via Zinc 17119284, 16325427, 16580781, 16410023
Anemia, Sickle Cell inferred via Zinc 16916123
Asthma inferred via Zinc 17085522
Brain Injuries inferred via Zinc 17109824
Carcinoma, Squamous Cell inferred via Zinc 16543248
Cardiovascular Diseases inferred via Zinc 16936243
Diabetes Mellitus inferred via Zinc 16479319
Esophageal Neoplasms inferred via Zinc 16543248
Gastritis inferred via Zinc 17241300
Growth Disorders inferred via Zinc 17217573
Heart Failure inferred via Zinc 17162251
Heart Injuries inferred via Zinc 17074742
Helicobacter Infections inferred via Zinc 17241300
Hepatolenticular Degeneration inferred via Zinc 17276780
Ischemia inferred via Zinc 16584753
Kidney Diseases inferred via Zinc 16960431
Kidney Failure, Chronic inferred via Zinc 16518626
Mammary Neoplasms, Experimental inferred via Zinc 12773700
Pre-Eclampsia inferred via Zinc 17114810
Prostatic Neoplasms inferred via Zinc 12429649, 16517595, 16700911, 16606632
Retinal Degeneration inferred via Zinc 16584753
Tongue Neoplasms inferred via Zinc 16543248
Parkinson Disease inferred via Rotenone 16140633, 15451049, 11445065
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375
Edema inferred via perfluorooctanoic acid 17259670, 12083418
Hepatomegaly inferred via perfluorooctanoic acid 3609246
Hyperalgesia inferred via perfluorooctanoic acid 12083418
Inflammation inferred via perfluorooctanoic acid 12083418
Leydig Cell Tumor inferred via perfluorooctanoic acid 8812269
Liver Neoplasms inferred via perfluorooctanoic acid 14757943
Niemann-Pick Disease, Type C inferred via perfluorooctanoic acid 9802331
Prenatal Exposure Delayed Effects inferred via perfluorooctanoic acid 17132714
Agricultural Workers' Diseases inferred via Paraquat 11874814
Gliosis inferred via Paraquat 11124998
Nerve Degeneration inferred via Paraquat 16893418
Parkinson Disease inferred via Paraquat 12911755, 15824117, 16140633, 15451049, 16510128, 11124998, 11445065, 11181820
Pneumonia inferred via Paraquat 12504350
Pulmonary Fibrosis inferred via Paraquat 16324872, 17997886
Respiratory Distress Syndrome, Adult inferred via Paraquat 11700416
Respiratory Sounds inferred via Paraquat 11874814
Retinal Degeneration inferred via Paraquat 16458197
Atherosclerosis inferred via Oxygen 16391483
Retinitis Pigmentosa inferred via manganese(III)-tetrakis(4-benzoic acid)porphyrin 16849425
Anemia, Sideroblastic inferred via manganese chloride 16910769
Anemia, Sideroblastic inferred via Manganese 16910769
Glioblastoma inferred via Manganese 17043766
Manganese Poisoning inferred via Manganese 16551646, 16568477
Movement Disorders inferred via Manganese 16551646
Nerve Degeneration inferred via Manganese 16551646
Parkinson Disease inferred via Manganese 11181820
Parkinsonian Disorders inferred via Manganese 16140633
Agricultural Workers' Diseases inferred via Lindane 12661182
Breast Neoplasms inferred via Lindane 14688026
Neoplasms inferred via Lindane 16818664, 12807735
Prostatic Neoplasms inferred via Lindane 14688026, 12661182
Seizures inferred via Lindane 7539098
Seizures inferred via Kainic Acid 16336964, 10686065
Liver Diseases inferred via Hemin 17173083
Adenocarcinoma inferred via Doxorubicin 17418594
Bone Marrow Neoplasms inferred via Doxorubicin 14601052
Brain Neoplasms inferred via Doxorubicin 17150277
Breast Neoplasms inferred via Doxorubicin 15692762, 18382427, 17369602, 16264153, 15136595, 11325840, 16322301, 16096432, 15993339, 15634643, 15567936, 15994142, 15668708, 18234424, 16935488, 18628466, 17426702, 17983394, 16826403, 15939500
Carcinoid Tumor inferred via Doxorubicin 16051944
Carcinoma, Hepatocellular inferred via Doxorubicin 18059187, 16023760, 16234567, 17876044
Carcinoma, Renal Cell inferred via Doxorubicin 16201981
Cardiomyopathies inferred via Doxorubicin 16952015, 15811867, 17382496, 17974986, 17308081, 17007740, 16731534, 18627295, 15505089, 16278810, 15476868, 16269455, 16109756, 16242529, 16364871, 16651473, 17351982, 17131338, 16455267, 17329180
Cardiomyopathy, Dilated inferred via Doxorubicin 17334414, 16243910
Colorectal Neoplasms inferred via Doxorubicin 18259882
Drug Toxicity inferred via Doxorubicin 18602426
Endometrial Neoplasms inferred via Doxorubicin 17359293
Endomyocardial Fibrosis inferred via Doxorubicin 18037988
Glioblastoma inferred via Doxorubicin 17150277
Head and Neck Neoplasms inferred via Doxorubicin 15692506
Heart Diseases inferred via Doxorubicin 16707910, 16330681, 16879835, 16244372, 16244371, 16144979
Hemangiosarcoma inferred via Doxorubicin 15692506
Hepatitis, Toxic inferred via Doxorubicin 17416283
Hodgkin Disease inferred via Doxorubicin 17606976, 18501091, 15147373
Kidney Diseases inferred via Doxorubicin 16775033, 15369732
Kidney Failure inferred via Doxorubicin 17922066
Kidney Failure, Chronic inferred via Doxorubicin 16707910
Leukemia, Erythroblastic, Acute inferred via Doxorubicin 16085563
Liver Cirrhosis, Experimental inferred via Doxorubicin 16595196, 16439617
Liver Neoplasms, Experimental inferred via Doxorubicin 17085340, 16842330
Lung Neoplasms inferred via Doxorubicin 17418594
Lymphoma inferred via Doxorubicin 16098063
Lymphoma, Non-Hodgkin inferred via Doxorubicin 17654614
Lymphoma, T-Cell inferred via Doxorubicin 15621674
Mammary Neoplasms, Experimental inferred via Doxorubicin 15458769
Melanoma inferred via Doxorubicin 16827129
Mucositis inferred via Doxorubicin 17415656
Neoplasm Metastasis inferred via Doxorubicin 18259882
Nephrotic Syndrome inferred via Doxorubicin 15640375, 16889571
Neuroblastoma inferred via Doxorubicin 15555623
Osteosarcoma inferred via Doxorubicin 15930896
Phyllodes Tumor inferred via Doxorubicin 17983394
Prostatic Neoplasms inferred via Doxorubicin 15897917, 18437689, 15749863, 16888761, 16729912, 16868541
Sarcoma inferred via Doxorubicin 18313854, 17710206, 17203757, 16767912, 15675481, 15625365
Sarcoma, Ewing's inferred via Doxorubicin 14601052, 16326096
Sarcoma, Kaposi inferred via Doxorubicin 17846226
Skin Neoplasms inferred via Doxorubicin 15692506
Soft Tissue Neoplasms inferred via Doxorubicin 16767912, 15625365, 17203757
Thyroid Neoplasms inferred via Doxorubicin 17909728, 16010429
Urinary Bladder Neoplasms inferred via Doxorubicin 17653716
Ventricular Dysfunction, Left inferred via Doxorubicin 17334414, 16364871
Breast Neoplasms inferred via Deferoxamine 15993339
Cell Transformation, Neoplastic inferred via Cadmium 17332340
Kidney Diseases inferred via Cadmium 16962696, 16322080
Prostatic Neoplasms inferred via Cadmium 17075824
Alzheimer Disease inferred via Aluminum 10721010
Inflammation inferred via Aluminum 16052892
Lung Diseases inferred via Aluminum 16052892
Multiple Sclerosis, Chronic Progressive inferred via Aluminum 17086897
Multiple Sclerosis, Relapsing-Remitting inferred via Aluminum 17086897

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Martins-de-Souza D, et al. (2009) "Proteomic analysis of dorsolateral prefrontal cortex indicates the involvement of cytoskeleton, oligodendrocyte, energy metabolism and new potential markers in schizophrenia." J Psychiatr Res. 43(11):978-986. PMID:19110265
  2. [ + ] Barbe L, et al. (2008) "Toward a confocal subcellular atlas of the human proteome." Mol Cell Proteomics. 7(3):499-508. PMID:18029348
  3. [ + ] Tsui KH, et al. (2006) "Manganese antagonizes iron blocking mitochondrial aconitase expression in human prostate carcinoma cells." Asian J Androl. 8(3):307-315. PMID:16625280
  4. [ + ] Yu Z, et al. (2006) "Characterization of the mitochondrial aconitase promoter and the identification of transcription factor binding." Prostate. 66(10):1061-1069. PMID:16598741
  5. [ + ] Ahmed M, et al. (2005) "Protein profiling of human pancreatic islets by two-dimensional gel electrophoresis and mass spectrometry." J Proteome Res. 4(3):931-940. PMID:15952740
  6. [ + ] Guo D, et al. (2005) "Proteomic analysis of SUMO4 substrates in HEK293 cells under serum starvation-induced stress." Biochem Biophys Res Commun. 337(4):1308-1318. PMID:16236267
  7. [ + ] Juang HH, et al. (2004) "Modulation of mitochondrial aconitase on the bioenergy of human prostate carcinoma cells." Mol Genet Metab. 81(3):244-252. PMID:14972331
  8. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  9. [ + ] Collins JE, et al. (2004) "A genome annotation-driven approach to cloning the human ORFeome." Genome Biol. 5(10):R84. PMID:15461802
  10. [ + ] Laiho P, et al. (2003) "Mutation and LOH analysis of ACO2 in colorectal cancer: no evidence of biallelic genetic inactivation." J Med Genet. 40(5):e73. PMID:12746427
  11. [ + ] Bota DA, et al. (2002) "Lon protease preferentially degrades oxidized mitochondrial aconitase by an ATP-stimulated mechanism." Nat Cell Biol. 4(9):674-680. PMID:12198491
  12. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  13. [ + ] Hirosawa M, et al. (2001) "Identification of novel transcribed sequences on human chromosome 22 by expressed sequence tag mapping." DNA Res. 8(1):1-9. PMID:11258795
  14. [ + ] Dunham I, et al. (1999) "The DNA sequence of human chromosome 22." Nature. 402(6761):489-495. PMID:10591208
  15. [ + ] Mirel DB, et al. (1998) "Characterization of the human mitochondrial aconitase gene (ACO2)." Gene. 213(1-2):205-218. PMID:9630632
  16. [ + ] Gruer MJ, et al. (1997) "The aconitase family: three structural variations on a common theme." Trends Biochem Sci. 22(1):3-6. PMID:9020582
  17. [ + ] Klausner RD, et al. (1993) "A double life: cytosolic aconitase as a regulatory RNA binding protein." Mol Biol Cell. 4(1):1-5. PMID:8443405
  18. [ + ] Dawson SJ, et al. (1992) "Treatment of Haemophilus aphrophilus endocarditis with ciprofloxacin." J Infect. 24(3):317-320. PMID:1602151
  19. [ + ] Baldwin GS, et al. (1991) "Purification and partial amino acid sequence of human aconitase." Protein Seq Data Anal. 4(2):63-67. PMID:1946331
  20. [ + ] Geurts van Kessel AH, et al. (1980) "Regional localization of the genes coding for human ACO2, ARSA, and NAGA on chromosome 22." Cytogenet Cell Genet. 28(3):169-172. PMID:7192199
  21. [ + ] Meera Khan P, et al. (1978) "Assignment of the mitochondrial aconitase gene (ACONM) to human chromosome 22." Cytogenet Cell Genet. 22(1-6):212-214. PMID:752476
  22. [ + ] Sparkes RS, et al. (1978) "Aconitase (E.C. 4.2.1.3) mitochondrial locus (ACONM) mapped to human chromosome 22." Cytogenet Cell Genet. 22(1-6):226-227. PMID:752479
  23. [ + ] Slaughter CA, et al. (1978) "Assignment of the locus ACONM to chromosome 22." Cytogenet Cell Genet. 22(1-6):223-225. PMID:752478
  24. [ + ] Slaughter CA, et al. (1977) "The distribution and properties of aconitase isozymes in man." Ann Hum Genet. 40(4):385-401. PMID:879710
  25. [ + ] Slaughter CA, et al. (1975) "Aconitase polymorphism in man." Ann Hum Genet. 39(2):193-202. PMID:1052766