ace2 | GeneID:492331 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 492331 Official Symbol ace2
Locus N/A Gene Type protein-coding
Synonyms zgc:92514
Full Name angiotensin I converting enzyme (peptidyl-dipeptidase A) 2
Description angiotensin I converting enzyme (peptidyl-dipeptidase A) 2
Chromosome N/A
Also Known As angiotensin I converting enzyme 2
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 41448

ID Symbol Protein Species
GeneID:59272 ACE2 NP_068576.1 Homo sapiens
GeneID:70008 Ace2 NP_081562.2 Mus musculus
GeneID:180780 acn-1 NP_001024453.1 Caenorhabditis elegans
GeneID:302668 Ace2 NP_001012006.1 Rattus norvegicus
GeneID:418623 ACE2 XP_416822.2 Gallus gallus
GeneID:480847 ACE2 XP_537964.2 Canis lupus familiaris
GeneID:492331 ace2 NP_001007298.1 Danio rerio

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016020 Component membrane
GO:0004180 Function carboxypeptidase activity
GO:0008237 Function metallopeptidase activity
GO:0008241 Function peptidyl-dipeptidase activity
GO:0006508 Process proteolysis

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001007297 NP_001007298

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000003712 MI0002005 dre-miR-142a-5p CAUAAAGUAGAAAGCACUACU
ENSDART00000003712 MI0001366 dre-miR-181b AACAUUCAUUGCUGUCGGUGGG
ENSDART00000003712 MI0001367 dre-miR-181b AACAUUCAUUGCUGUCGGUGGG
ENSDART00000003712 MI0002024 dre-miR-181c CACAUUCAUUGCUGUCGGUGGG
ENSDART00000003712 MI0001903 dre-miR-19a* CUAGUUUUGCAUAGUUGCACUA
ENSDART00000003712 MI0001376 dre-miR-203a GUGAAAUGUUUAGGACCACUUG
ENSDART00000003712 MI0004766 dre-miR-499 UUAAGACUUGCAGUGAUGUUUA
ENSDART00000003712 MI0004782 dre-miR-736 GUAAGACGAACAAAAAGUUUU
ENSDART00000003712 MI0004868 xtr-miR-215 AUGACCUAUGAAAUGACAGCC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Whitlock KE, et al. (2006) "Development of GnRH cells: Setting the stage for puberty." Mol Cell Endocrinol. 254-255():39-50. PMID:16777316
  2. [ + ] Chou CF, et al. (2006) "ACE2 orthologues in non-mammalian vertebrates (Danio, Gallus, Fugu, Tetraodon and Xenopus)." Gene. 377():46-55. PMID:16781089
  3. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932