ABCB7 | GeneID:491967 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 491967 Official Symbol ABCB7
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family B (MDR/TAP), member 7
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 3175

ID Symbol Protein Species
GeneID:22 ABCB7 NP_004290.2 Homo sapiens
GeneID:38193 CG7955 NP_728642.2 Drosophila melanogaster
GeneID:171807 abtm-1 NP_001021830.1 Caenorhabditis elegans
GeneID:302395 Abcb7 NP_997683.1 Rattus norvegicus
GeneID:422326 ABCB7 XP_420301.1 Gallus gallus
GeneID:491967 ABCB7 XP_549087.1 Canis lupus familiaris
GeneID:533669 ABCB7 XP_613148.2 Bos taurus
GeneID:566515 wu:fc20c02 XP_694879.2 Danio rerio
GeneID:828980 ATM2 NP_194591.1 Arabidopsis thaliana
GeneID:828981 ATM1 NP_567813.1 Arabidopsis thaliana
GeneID:835939 STA1 NP_200635.1 Arabidopsis thaliana
GeneID:855347 ATM1 NP_014030.1 Saccharomyces cerevisiae
GeneID:1276974 AgaP_AGAP006364 XP_316391.2 Anopheles gambiae
GeneID:2542779 atm1 NP_594288.2 Schizosaccharomyces pombe
GeneID:2676565 MGG_03406 XP_360863.1 Magnaporthe grisea
GeneID:2706358 NCU05029.1 XP_324386.1 Neurospora crassa
GeneID:2896392 KLLA0A10131g XP_451443.1 Kluyveromyces lactis
GeneID:4622625 AGOS_AGL335W NP_986332.1 Eremothecium gossypii

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_549087 XP_549087

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000027270 MI0004737 bta-miR-148a UCAGUGCACUACAGAACUUUGU
ENSCAFT00000027270 MI0005030 bta-miR-148b UCAGUGCAUCACAGAACUUUGU
ENSCAFT00000027270 MI0005033 bta-miR-186 CAAAGAAUUCUCCUUUUGGGCU
ENSCAFT00000027270 MI0005460 bta-miR-19a UGUGCAAAUCUAUGCAAAACUGA
ENSCAFT00000027270 MI0004748 bta-miR-320 AAAAGCUGGGUUGAGAGGGCGA
ENSCAFT00000027270 MI0004763 bta-miR-34b AGGCAGUGUAAUUAGCUGAUUG
ENSCAFT00000027270 MI0000111 hsa-miR-105 UCAAAUGCUCAGACUCCUGUGGU
ENSCAFT00000027270 MI0000112 hsa-miR-105 UCAAAUGCUCAGACUCCUGUGGU
ENSCAFT00000027270 MI0000448 hsa-miR-130a CAGUGCAAUGUUAAAAGGGCAU
ENSCAFT00000027270 MI0000748 hsa-miR-130b CAGUGCAAUGAUGAAAGGGCAU
ENSCAFT00000027270 MI0000462 hsa-miR-152 UCAGUGCAUGACAGAACUUGG
ENSCAFT00000027270 MI0000488 hsa-miR-194 UGUAACAGCAACUCCAUGUGGA
ENSCAFT00000027270 MI0000732 hsa-miR-194 UGUAACAGCAACUCCAUGUGGA
ENSCAFT00000027270 MI0000283 hsa-miR-203 GUGAAAUGUUUAGGACCACUAG
ENSCAFT00000027270 MI0000292 hsa-miR-216a UAAUCUCAGCUGGCAACUGUGA
ENSCAFT00000027270 MI0000745 hsa-miR-301a CAGUGCAAUAGUAUUGUCAAAGC
ENSCAFT00000027270 MI0000779 hsa-miR-371-5p ACUCAAACUGUGGGGGCACU
ENSCAFT00000027270 MI0003144 hsa-miR-515-5p UUCUCCAAAAGAAAGCACUUUCUG
ENSCAFT00000027270 MI0003147 hsa-miR-515-5p UUCUCCAAAAGAAAGCACUUUCUG
ENSCAFT00000027270 MI0003558 hsa-miR-553 AAAACGGUGAGAUUUUGUUUU
ENSCAFT00000027270 MI0003583 hsa-miR-576-3p AAGAUGUGGAAAAAUUGGAAUC
ENSCAFT00000027270 MI0003906 hsa-miR-802 CAGUAACAAAGAUUCAUCCUUGU
ENSCAFT00000027270 MI0005510 mmu-miR-466g AUACAGACACAUGCACACACA
ENSCAFT00000027270 MI0004708 mmu-miR-721 CAGUGCAAUUAAAAGGGGGAA
ENSCAFT00000027270 MI0005204 mmu-miR-805 GAAUUGAUCAGGACAUAGGG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_549087  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene