ABHD15 | GeneID:491179 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 491179 Official Symbol ABHD15
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description abhydrolase domain containing 15
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 12142

ID Symbol Protein Species
GeneID:67477 1300007F04Rik NP_080461.2 Mus musculus
GeneID:116236 LOC116236 NP_937790.1 Homo sapiens
GeneID:303343 RGD1304598 XP_220745.3 Rattus norvegicus
GeneID:468200 LOC468200 XP_523591.2 Pan troglodytes
GeneID:491179 LOC491179 XP_548299.2 Canis lupus familiaris
GeneID:528755 LOC528755 XP_607187.3 Bos taurus
GeneID:560644 LOC560644 XP_689131.2 Danio rerio

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_548299 XP_548299

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000030033 MI0005057 bta-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSCAFT00000030033 MI0005451 bta-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSCAFT00000030033 MI0005452 bta-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSCAFT00000030033 MI0005453 bta-let-7b UGAGGUAGUAGGUUGUGUGGUU
ENSCAFT00000030033 MI0005454 bta-let-7c UGAGGUAGUAGGUUGUAUGGUU
ENSCAFT00000030033 MI0005455 bta-let-7e UGAGGUAGGAGGUUGUAUAGU
ENSCAFT00000030033 MI0004734 bta-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENSCAFT00000030033 MI0005062 bta-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENSCAFT00000030033 MI0005051 bta-let-7g UGAGGUAGUAGUUUGUACAGUU
ENSCAFT00000030033 MI0005065 bta-let-7i UGAGGUAGUAGUUUGUGCUGUU
ENSCAFT00000030033 MI0005041 bta-miR-22-5p AGUUCUUCAGUGGCAAGCUUUA
ENSCAFT00000030033 MI0004761 bta-miR-30b UGUAAACAUCCUACACUCAGCU
ENSCAFT00000030033 MI0005064 bta-miR-30c UGUAAACAUCCUACACUCUCAGC
ENSCAFT00000030033 MI0005464 bta-miR-34a UGGCAGUGUCUUAGCUGGUUGU
ENSCAFT00000030033 MI0005050 bta-miR-93 CAAAGUGCUGUUCGUGCAGGUA
ENSCAFT00000030033 MI0000437 hsa-miR-1 UGGAAUGUAAAGAAGUAUGUAU
ENSCAFT00000030033 MI0000651 hsa-miR-1 UGGAAUGUAAAGAAGUAUGUAU
ENSCAFT00000030033 MI0000262 hsa-miR-147 GUGUGUGGAAAUGCUUCUGC
ENSCAFT00000030033 MI0005544 hsa-miR-147b GUGUGCGGAAAUGCUUCUGCUA
ENSCAFT00000030033 MI0000482 hsa-miR-185 UGGAGAGAAAGGCAGUUCCUGA
ENSCAFT00000030033 MI0000490 hsa-miR-206 UGGAAUGUAAGGAAGUGUGUGG
ENSCAFT00000030033 MI0000744 hsa-miR-299-3p UAUGUGGGAUGGUAAACCGCUU
ENSCAFT00000030033 MI0000804 hsa-miR-328 CUGGCCCUCUCUGCCCUUCCGU
ENSCAFT00000030033 MI0003184 hsa-miR-500 UAAUCCUUGCUACCUGGGUGAGA
ENSCAFT00000030033 MI0003166 hsa-miR-520g ACAAAGUGCUUCCCUUUAGAGUGU
ENSCAFT00000030033 MI0003175 hsa-miR-520h ACAAAGUGCUUCCCUUUAGAGU
ENSCAFT00000030033 MI0003686 hsa-miR-542-3p UGUGACAGAUUGAUAACUGAAA
ENSCAFT00000030033 MI0003578 hsa-miR-571 UGAGUUGGCCAUCUGAGUGAG
ENSCAFT00000030033 MI0003623 hsa-miR-610 UGAGCUAAAUGUGUGCUGGGA
ENSCAFT00000030033 MI0005537 hsa-miR-888 UACUCAAAAAGCUGUCAGUCA
ENSCAFT00000030033 MI0005713 hsa-miR-921 CUAGUGAGGGACAGAACCAGGAUUC
ENSCAFT00000030033 MI0003517 mmu-miR-546 AUGGUGGCACGGAGUC
ENSCAFT00000030033 MI0004634 mmu-miR-677 UUCAGUGAUGAUUAGCUUCUGA
ENSCAFT00000030033 MI0004647 mmu-miR-684 AGUUUUCCCUUCAAGUCAA
ENSCAFT00000030033 MI0004648 mmu-miR-684 AGUUUUCCCUUCAAGUCAA
ENSCAFT00000030033 MI0004660 mmu-miR-692 AUCUCUUUGAGCGCCUCACUC
ENSCAFT00000030033 MI0004661 mmu-miR-692 AUCUCUUUGAGCGCCUCACUC
ENSCAFT00000030033 MI0004681 mmu-miR-697 AACAUCCUGGUCCUGUGGAGA
ENSCAFT00000030033 MI0004700 mmu-miR-715 CUCCGUGCACACCCCCGCGUG
ENSCAFT00000030033 MI0000636 rno-miR-349 CAGCCCUGCUGUCUUAACCUCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_548299  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene