ABCC3 | GeneID:491084 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 491084 Official Symbol ABCC3
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family C (CFTR/MRP), member 3
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 68364

ID Symbol Protein Species
GeneID:8714 ABCC3 NP_003777.2 Homo sapiens
GeneID:76408 Abcc3 NP_083876.3 Mus musculus
GeneID:140668 Abcc3 NP_542148.1 Rattus norvegicus
GeneID:181202 mrp-4 NP_509658.1 Caenorhabditis elegans
GeneID:422099 ABCC3 XP_420102.2 Gallus gallus
GeneID:491084 ABCC3 XP_548204.2 Canis lupus familiaris
GeneID:533151 ABCC3 XP_612461.3 Bos taurus
GeneID:747938 ABCC3 XP_001158914.1 Pan troglodytes
GeneID:839921 ATMRP13 NP_174330.1 Arabidopsis thaliana
GeneID:839922 ATMRP12 NP_174331.2 Arabidopsis thaliana

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_548204 XP_548204

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000027259 MI0005065 bta-let-7i UGAGGUAGUAGUUUGUGCUGUU
ENSCAFT00000027259 MI0004758 bta-miR-199a-3p ACAGUAGUCUGCACAUUGGUUA
ENSCAFT00000027259 MI0005037 bta-miR-200a UAACACUGUCUGGUAACGAUGUU
ENSCAFT00000027259 MI0005021 bta-miR-380-3p UAUGUAAUGUGGUCCACGUCU
ENSCAFT00000027259 MI0005021 bta-miR-380-5p UGGUUGACCAUAGAACAUGCGC
ENSCAFT00000027259 MI0005022 bta-miR-487a AAUCAUACAGGGACAUCCAGU
ENSCAFT00000027259 MI0005060 bta-miR-487b AAUCGUACAGGGUCAUCCACUU
ENSCAFT00000027259 MI0005467 bta-miR-497 CAGCAGCACACUGUGGUUUGUA
ENSCAFT00000027259 MI0000262 hsa-miR-147 GUGUGUGGAAAUGCUUCUGC
ENSCAFT00000027259 MI0000283 hsa-miR-203 GUGAAAUGUUUAGGACCACUAG
ENSCAFT00000027259 MI0000806 hsa-miR-337-5p GAACGGCUUCAUACAGGAGUU
ENSCAFT00000027259 MI0000815 hsa-miR-339-5p UCCCUGUCCUCCAGGAGCUCACG
ENSCAFT00000027259 MI0000779 hsa-miR-371-5p ACUCAAACUGUGGGGGCACU
ENSCAFT00000027259 MI0003195 hsa-miR-508-5p UACUCCAGAGGGCGUCACUCAUG
ENSCAFT00000027259 MI0003144 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENSCAFT00000027259 MI0003147 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENSCAFT00000027259 MI0003145 hsa-miR-519e AAGUGCCUCCUUUUAGAGUGUU
ENSCAFT00000027259 MI0003149 hsa-miR-520a-5p CUCCAGAGGGAAGUACUUUCU
ENSCAFT00000027259 MI0003143 hsa-miR-520e AAAGUGCUUCCUUUUUGAGGG
ENSCAFT00000027259 MI0003146 hsa-miR-520f AAGUGCUUCCUUUUAGAGGGUU
ENSCAFT00000027259 MI0003152 hsa-miR-525-5p CUCCAGAGGGAUGCACUUUCU
ENSCAFT00000027259 MI0003630 hsa-miR-548c-3p CAAAAAUCUCAAUUACUUUUGC
ENSCAFT00000027259 MI0003600 hsa-miR-550 AGUGCCUGAGGGAGUAAGAGCCC
ENSCAFT00000027259 MI0003601 hsa-miR-550 AGUGCCUGAGGGAGUAAGAGCCC
ENSCAFT00000027259 MI0003577 hsa-miR-570 CGAAAACAGCAAUUACCUUUGC
ENSCAFT00000027259 MI0003636 hsa-miR-622 ACAGUCUGCUGAGGUUGGAGC
ENSCAFT00000027259 MI0003639 hsa-miR-625 AGGGGGAAAGUUCUAUAGUCC
ENSCAFT00000027259 MI0003645 hsa-miR-631 AGACCUGGCCCAGACCUCAGC
ENSCAFT00000027259 MI0003653 hsa-miR-638 AGGGAUCGCGGGCGGGUGGCGGCCU
ENSCAFT00000027259 MI0005563 hsa-miR-665 ACCAGGAGGCUGAGGCCCCU
ENSCAFT00000027259 MI0005118 hsa-miR-770-5p UCCAGUACCACGUGUCAGGGCCA
ENSCAFT00000027259 MI0005562 hsa-miR-887 GUGAACGGGCGCCAUCCCGAGG
ENSCAFT00000027259 MI0000388 mmu-miR-290-5p ACUCAAACUAUGGGGGCACUUU
ENSCAFT00000027259 MI0003518 mmu-miR-540-5p CAAGGGUCACCCUCUGACUCUGU
ENSCAFT00000027259 MI0004673 mmu-miR-669c AUAGUUGUGUGUGGAUGUGUGU
ENSCAFT00000027259 MI0004640 mmu-miR-680 GGGCAUCUGCUGACAUGGGGG
ENSCAFT00000027259 MI0004641 mmu-miR-680 GGGCAUCUGCUGACAUGGGGG
ENSCAFT00000027259 MI0004642 mmu-miR-680 GGGCAUCUGCUGACAUGGGGG
ENSCAFT00000027259 MI0004659 mmu-miR-691 AUUCCUGAAGAGAGGCAGAAAA
ENSCAFT00000027259 MI0004687 mmu-miR-703 AAAACCUUCAGAAGGAAAGAA
ENSCAFT00000027259 MI0004554 mmu-miR-759 GCAGAGUGCAAACAAUUUUGAC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_548204  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene