ABCA8 | GeneID:490898 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 490898 Official Symbol ABCA8
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family A (ABC1), member 8
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 56029

ID Symbol Protein Species
GeneID:10351 ABCA8 NP_009099.1 Homo sapiens
GeneID:27404 Abca8b NP_038879.1 Mus musculus
GeneID:303637 Abca8 XP_221074.4 Rattus norvegicus
GeneID:417440 ABCA8 XP_415691.2 Gallus gallus
GeneID:454847 ABCA8 XP_001165831.1 Pan troglodytes
GeneID:490898 ABCA8 XP_548020.2 Canis lupus familiaris

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_548020 XP_548020

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000017436 MI0005010 bta-miR-140 UACCACAGGGUAGAACCACGGA
ENSCAFT00000017436 MI0005011 bta-miR-142 CAUAAAGUAGAAAGCACUAC
ENSCAFT00000017436 MI0005034 bta-miR-191 CAACGGAAUCCCAAAAGCAGCUG
ENSCAFT00000017436 MI0004751 bta-miR-99a AACCCGUAGAUCCGAUCUUGU
ENSCAFT00000017436 MI0005469 bta-miR-99b CACCCGUAGAACCGACCUUGCG
ENSCAFT00000017436 MI0000102 hsa-miR-100 AACCCGUAGAUCCGAACUUGUG
ENSCAFT00000017436 MI0000804 hsa-miR-328 CUGGCCCUCUCUGCCCUUCCGU
ENSCAFT00000017436 MI0002466 hsa-miR-376b AUCAUAGAGGAAAAUCCAUGUU
ENSCAFT00000017436 MI0003134 hsa-miR-494 UGAAACAUACACGGGAAACCUC
ENSCAFT00000017436 MI0003197 hsa-miR-510 UACUCAGGAGAGUGGCAAUCAC
ENSCAFT00000017436 MI0003612 hsa-miR-548a-5p AAAAGUAAUUGCGAGUUUUACC
ENSCAFT00000017436 MI0003596 hsa-miR-548b-5p AAAAGUAAUUGUGGUUUUGGCC
ENSCAFT00000017436 MI0003630 hsa-miR-548c-5p AAAAGUAAUUGCGGUUUUUGCC
ENSCAFT00000017436 MI0003668 hsa-miR-548d-5p AAAAGUAAUUGUGGUUUUUGCC
ENSCAFT00000017436 MI0003671 hsa-miR-548d-5p AAAAGUAAUUGUGGUUUUUGCC
ENSCAFT00000017436 MI0003589 hsa-miR-582-3p UAACUGGUUGAACAACUGAACC
ENSCAFT00000017436 MI0003643 hsa-miR-629 UGGGUUUACGUUGGGAGAACU
ENSCAFT00000017436 MI0003662 hsa-miR-647 GUGGCUGCACUCACUUCCUUC
ENSCAFT00000017436 MI0005562 hsa-miR-887 GUGAACGGGCGCCAUCCCGAGG
ENSCAFT00000017436 MI0004671 mmu-miR-467b GUAAGUGCCUGCAUGUAUAUG
ENSCAFT00000017436 MI0005512 mmu-miR-467c UAAGUGCGUGCAUGUAUAUGUG
ENSCAFT00000017436 MI0004662 mmu-miR-693-5p CAGCCACAUCCGAAAGUUUUC
ENSCAFT00000017436 MI0005207 mmu-miR-743a GAAAGACACCAAGCUGAGUAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_548020  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene