ABCD4 | GeneID:490781 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 490781 Official Symbol ABCD4
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family D (ALD), member 4
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 3703

ID Symbol Protein Species
GeneID:5826 ABCD4 NP_005041.1 Homo sapiens
GeneID:19300 Abcd4 NP_033018.1 Mus musculus
GeneID:179968 pmp-3 NP_506620.1 Caenorhabditis elegans
GeneID:299196 Abcd4 XP_001061210.1 Rattus norvegicus
GeneID:423349 ABCD4 XP_421264.2 Gallus gallus
GeneID:453032 ABCD4 XP_001156286.1 Pan troglodytes
GeneID:490781 ABCD4 XP_547903.2 Canis lupus familiaris
GeneID:767748 zgc:153503 NP_001070185.1 Danio rerio
GeneID:841876 AT1G54350 NP_175837.2 Arabidopsis thaliana
GeneID:4324587 Os01g0218700 NP_001042413.1 Oryza sativa

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_547903 XP_547903
2 XM_862907 XP_868000
3 XM_862912 XP_868005
4 XM_862917 XP_868010

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000026780 MI0005057 bta-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSCAFT00000026780 MI0005451 bta-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSCAFT00000026780 MI0005452 bta-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSCAFT00000026780 MI0005453 bta-let-7b UGAGGUAGUAGGUUGUGUGGUU
ENSCAFT00000026780 MI0005454 bta-let-7c UGAGGUAGUAGGUUGUAUGGUU
ENSCAFT00000026780 MI0005026 bta-let-7d AGAGGUAGUAGGUUGCAUAGUU
ENSCAFT00000026780 MI0005455 bta-let-7e UGAGGUAGGAGGUUGUAUAGU
ENSCAFT00000026780 MI0004734 bta-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENSCAFT00000026780 MI0005062 bta-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENSCAFT00000026780 MI0005051 bta-let-7g UGAGGUAGUAGUUUGUACAGUU
ENSCAFT00000026780 MI0005065 bta-let-7i UGAGGUAGUAGUUUGUGCUGUU
ENSCAFT00000026780 MI0005058 bta-miR-150 UCUCCCAACCCUUGUACCAGUGU
ENSCAFT00000026780 MI0005025 bta-miR-98 UGAGGUAGUAAGUUGUAUUGUU
ENSCAFT00000026780 MI0000475 hsa-miR-136 ACUCCAUUUGUUUUGAUGAUGGA
ENSCAFT00000026780 MI0003129 hsa-miR-146b-3p UGCCCUGUGGACUCAGUUCUGG
ENSCAFT00000026780 MI0000272 hsa-miR-182 UUUGGCAAUGGUAGAACUCACACU
ENSCAFT00000026780 MI0000484 hsa-miR-188-3p CUCCCACAUGCAGGGUUUGCA
ENSCAFT00000026780 MI0000814 hsa-miR-338-5p AACAAUAUCCUGGUGCUGAGUG
ENSCAFT00000026780 MI0000779 hsa-miR-371-3p AAGUGCCGCCAUCUUUUGAGUGU
ENSCAFT00000026780 MI0001721 hsa-miR-431 UGUCUUGCAGGCCGUCAUGCA
ENSCAFT00000026780 MI0003125 hsa-miR-490-5p CCAUGGAUCUCCAGGUGGGU
ENSCAFT00000026780 MI0003144 hsa-miR-515-5p UUCUCCAAAAGAAAGCACUUUCUG
ENSCAFT00000026780 MI0003147 hsa-miR-515-5p UUCUCCAAAAGAAAGCACUUUCUG
ENSCAFT00000026780 MI0003567 hsa-miR-561 CAAAGUUUAAGAUCCUUGAAGU
ENSCAFT00000026780 MI0003573 hsa-miR-567 AGUAUGUUCUUCCAGGACAGAAC
ENSCAFT00000026780 MI0003586 hsa-miR-579 UUCAUUUGGUAUAAACCGCGAUU
ENSCAFT00000026780 MI0003636 hsa-miR-622 ACAGUCUGCUGAGGUUGGAGC
ENSCAFT00000026780 MI0003652 hsa-miR-637 ACUGGGGGCUUUCGGGCUCUGCGU
ENSCAFT00000026780 MI0003682 hsa-miR-658 GGCGGAGGGAAGUAGGUCCGUUGGU
ENSCAFT00000026780 MI0005532 hsa-miR-874 CUGCCCUGGCCCGAGGGACCGA
ENSCAFT00000026780 MI0005528 hsa-miR-892a CACUGUGUCCUUUCUGCGUAG
ENSCAFT00000026780 MI0005712 hsa-miR-920 GGGGAGCUGUGGAAGCAGUA
ENSCAFT00000026780 MI0000098 hsa-miR-96 UUUGGCACUAGCACAUUUUUGCU
ENSCAFT00000026780 MI0003539 mmu-miR-291b-3p AAAGUGCAUCCAUUUUGUUUGU
ENSCAFT00000026780 MI0005513 mmu-miR-467d UAAGUGCGCGCAUGUAUAUGCG
ENSCAFT00000026780 MI0002404 mmu-miR-469 UGCCUCUUUCAUUGAUCUUGGUGUCC
ENSCAFT00000026780 MI0005474 mmu-miR-881 AACUGUGUCUUUUCUGAAUAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene