ABCC6 | GeneID:489993 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 489993 Official Symbol ABCC6
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family C (CFTR/MRP), member 6
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 55559

ID Symbol Protein Species
GeneID:368 ABCC6 NP_001162.3 Homo sapiens
GeneID:27421 Abcc6 NP_061265.1 Mus musculus
GeneID:81642 Abcc6 NP_112275.1 Rattus norvegicus
GeneID:416600 ABCC6 XP_001234744.1 Gallus gallus
GeneID:489993 ABCC6 XP_547113.2 Canis lupus familiaris

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_547113 XP_547113

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000028908 MI0005067 bta-miR-25 CAUUGCACUUGUCUCGGUCUGA
ENSCAFT00000028908 MI0005049 bta-miR-455 UAUGUGCCUUUGGACUACAUC
ENSCAFT00000028908 MI0005024 bta-miR-92 UAUUGCACUUGUCCCGGCCUGU
ENSCAFT00000028908 MI0000762 hsa-miR-362-5p AAUCCUUGGAACCUAGGUGUGAGU
ENSCAFT00000028908 MI0003132 hsa-miR-493 UGAAGGUCUACUGUGUGCCAGG
ENSCAFT00000028908 MI0003640 hsa-miR-626 AGCUGUCUGAAAAUGUCUU
ENSCAFT00000028908 MI0003647 hsa-miR-632 GUGUCUGCUUCCUGUGGGA
ENSCAFT00000028908 MI0003683 hsa-miR-659 CUUGGUUCAGGGAGGGUCCCCA
ENSCAFT00000028908 MI0003834 hsa-miR-769-3p CUGGGAUCUCCGGGGUCUUGGUU
ENSCAFT00000028908 MI0005538 hsa-miR-892b CACUGGCUCCUUUCUGGGUAGA
ENSCAFT00000028908 MI0000630 mmu-miR-344 UGAUCUAGCCAAAGCCUGACUGU
ENSCAFT00000028908 MI0005495 mmu-miR-344 UGAUCUAGCCAAAGCCUGACUGU
ENSCAFT00000028908 MI0002399 mmu-miR-464 UACCAAGUUUAUUCUGUGAGAUA
ENSCAFT00000028908 MI0002403 mmu-miR-468 UAUGACUGAUGUGCGUGUGUCUG
ENSCAFT00000028908 MI0004601 mmu-miR-673-3p UCCGGGGCUGAGUUCUGUGCACC
ENSCAFT00000028908 MI0004677 mmu-miR-696 GCGUGUGCUUGCUGUGGG
ENSCAFT00000028908 MI0004678 mmu-miR-720 AUCUCGCUGGGGCCUCCA
ENSCAFT00000028915 MI0000293 hsa-miR-217 UACUGCAUCAGGAACUGAUUGGA
ENSCAFT00000028915 MI0003125 hsa-miR-490-3p CAACCUGGAGGACUCCAUGCUG
ENSCAFT00000028915 MI0003642 hsa-miR-628-3p UCUAGUAAGAGUGGCAGUCGA
ENSCAFT00000028915 MI0005564 hsa-miR-873 GCAGGAACUUGUGAGUCUCCU
ENSCAFT00000028915 MI0004699 mmu-miR-714 CGACGAGGGCCGGUCGGUCGC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_547113  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]