ABHD11 | GeneID:489803 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 489803 Official Symbol ABHD11
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description abhydrolase domain containing 11
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 5961

ID Symbol Protein Species
GeneID:31663 CG2059 NP_572388.1 Drosophila melanogaster
GeneID:68758 Abhd11 NP_660250.1 Mus musculus
GeneID:83451 ABHD11 NP_683710.1 Homo sapiens
GeneID:173096 R05D7.4 NP_493077.1 Caenorhabditis elegans
GeneID:185192 F32B4.6 NP_492942.1 Caenorhabditis elegans
GeneID:360831 Abhd11 XP_341105.1 Rattus norvegicus
GeneID:417473 ABHD11 XP_415721.2 Gallus gallus
GeneID:446169 abhd11 NP_001004290.1 Danio rerio
GeneID:472412 ABHD11 XP_001147903.1 Pan troglodytes
GeneID:489803 ABHD11 XP_546921.1 Canis lupus familiaris
GeneID:510109 ABHD11 NP_001029544.1 Bos taurus
GeneID:686139 LOC686139 XP_001066660.1 Rattus norvegicus
GeneID:810986 PF11_0441 XP_001348110.1 Plasmodium falciparum
GeneID:852919 YGR031W NP_011545.1 Saccharomyces cerevisiae
GeneID:1280255 AgaP_AGAP009289 XP_320086.1 Anopheles gambiae
GeneID:2541745 SPAC22H12.03 NP_593115.1 Schizosaccharomyces pombe
GeneID:2685094 MGG_06921 XP_370424.2 Magnaporthe grisea
GeneID:2709957 NCU01454.1 XP_327893.1 Neurospora crassa
GeneID:2897458 KLLA0B05863g XP_451797.1 Kluyveromyces lactis
GeneID:4619344 AGOS_ACL180C NP_983224.1 Eremothecium gossypii

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_546921 XP_546921
2 XM_852193 XP_857286

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000020011 MI0005057 bta-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSCAFT00000020011 MI0005451 bta-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSCAFT00000020011 MI0005452 bta-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSCAFT00000020011 MI0005453 bta-let-7b UGAGGUAGUAGGUUGUGUGGUU
ENSCAFT00000020011 MI0005454 bta-let-7c UGAGGUAGUAGGUUGUAUGGUU
ENSCAFT00000020011 MI0005026 bta-let-7d AGAGGUAGUAGGUUGCAUAGUU
ENSCAFT00000020011 MI0005455 bta-let-7e UGAGGUAGGAGGUUGUAUAGU
ENSCAFT00000020011 MI0004734 bta-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENSCAFT00000020011 MI0005062 bta-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENSCAFT00000020011 MI0005051 bta-let-7g UGAGGUAGUAGUUUGUACAGUU
ENSCAFT00000020011 MI0005007 bta-miR-10a UACCCUGUAGAUCCGAAUUUGUG
ENSCAFT00000020011 MI0004737 bta-miR-148a UCAGUGCACUACAGAACUUUGU
ENSCAFT00000020011 MI0005025 bta-miR-98 UGAGGUAGUAAGUUGUAUUGUU
ENSCAFT00000020011 MI0005544 hsa-miR-147b GUGUGCGGAAAUGCUUCUGCUA
ENSCAFT00000020011 MI0005536 hsa-miR-220c ACACAGGGCUGUUGUGAAGACU
ENSCAFT00000020011 MI0005523 hsa-miR-298 AGCAGAAGCAGGGAGGUUCUCCCA
ENSCAFT00000020011 MI0000808 hsa-miR-326 CCUCUGGGCCCUUCCUCCAG
ENSCAFT00000020011 MI0000804 hsa-miR-328 CUGGCCCUCUCUGCCCUUCCGU
ENSCAFT00000020011 MI0000779 hsa-miR-371-5p ACUCAAACUGUGGGGGCACU
ENSCAFT00000020011 MI0003125 hsa-miR-490-3p CAACCUGGAGGACUCCAUGCUG
ENSCAFT00000020011 MI0003144 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENSCAFT00000020011 MI0003147 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENSCAFT00000020011 MI0003145 hsa-miR-519e AAGUGCCUCCUUUUAGAGUGUU
ENSCAFT00000020011 MI0003600 hsa-miR-550 AGUGCCUGAGGGAGUAAGAGCCC
ENSCAFT00000020011 MI0003601 hsa-miR-550 AGUGCCUGAGGGAGUAAGAGCCC
ENSCAFT00000020011 MI0003594 hsa-miR-586 UAUGCAUUGUAUUUUUAGGUCC
ENSCAFT00000020011 MI0003617 hsa-miR-604 AGGCUGCGGAAUUCAGGAC
ENSCAFT00000020011 MI0003623 hsa-miR-610 UGAGCUAAAUGUGUGCUGGGA
ENSCAFT00000020011 MI0003633 hsa-miR-619 GACCUGGACAUGUUUGUGCCCAGU
ENSCAFT00000020011 MI0003760 hsa-miR-671-5p AGGAAGCCCUGGAGGGGCUGGAG
ENSCAFT00000020011 MI0005541 hsa-miR-875-3p CCUGGAAACACUGAGGUUGUG
ENSCAFT00000020011 MI0005541 hsa-miR-875-5p UAUACCUCAGUUUUAUCAGGUG
ENSCAFT00000020011 MI0005560 hsa-miR-885-3p AGGCAGCGGGGUGUAGUGGAUA
ENSCAFT00000020011 MI0005527 hsa-miR-886-5p CGGGUCGGAGUUAGCUCAAGCGG
ENSCAFT00000020011 MI0005712 hsa-miR-920 GGGGAGCUGUGGAAGCAGUA
ENSCAFT00000020011 MI0000388 mmu-miR-290-5p ACUCAAACUAUGGGGGCACUUU
ENSCAFT00000020011 MI0000390 mmu-miR-292-5p ACUCAAACUGGGGGCUCUUUUG
ENSCAFT00000020011 MI0000625 mmu-miR-341 UCGGUCGAUCGGUCGGUCGGU
ENSCAFT00000020011 MI0004553 mmu-miR-666-3p GGCUGCAGCGUGAUCGCCUGCU
ENSCAFT00000020011 MI0004689 mmu-miR-705 GGUGGGAGGUGGGGUGGGCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene