AASDHPPT | GeneID:489426 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 489426 Official Symbol AASDHPPT
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 9130

ID Symbol Protein Species
GeneID:60496 AASDHPPT NP_056238.2 Homo sapiens
GeneID:67618 Aasdhppt NP_080552.2 Mus musculus
GeneID:180425 T04G9.4 NP_508153.1 Caenorhabditis elegans
GeneID:189061 T28H10.1 NP_506135.1 Caenorhabditis elegans
GeneID:300328 Aasdhppt XP_217078.3 Rattus norvegicus
GeneID:317852 eap NP_729788.1 Drosophila melanogaster
GeneID:418975 AASDHPPT XP_417169.2 Gallus gallus
GeneID:451524 AASDHPPT XP_508734.2 Pan troglodytes
GeneID:489426 AASDHPPT XP_546544.2 Canis lupus familiaris
GeneID:519816 AASDHPPT XP_869172.1 Bos taurus
GeneID:619247 zgc:114148 NP_001028901.1 Danio rerio
GeneID:784811 AASDHPPT XP_001250766.1 Bos taurus
GeneID:4349713 Os11g0136500 NP_001065690.1 Oryza sativa
GeneID:4351429 Os12g0133400 NP_001066088.1 Oryza sativa

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_546544 XP_546544

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000023457 MI0004737 bta-miR-148a UCAGUGCACUACAGAACUUUGU
ENSCAFT00000023457 MI0005031 bta-miR-17-3p ACUGCAGUGAAGGCACUUGU
ENSCAFT00000023457 MI0005023 bta-miR-545 AUCAACAAACAUUUAUUGUGUG
ENSCAFT00000023457 MI0000448 hsa-miR-130a CAGUGCAAUGUUAAAAGGGCAU
ENSCAFT00000023457 MI0000748 hsa-miR-130b CAGUGCAAUGAUGAAAGGGCAU
ENSCAFT00000023457 MI0005570 hsa-miR-208b AUAAGACGAACAAAAGGUUUGU
ENSCAFT00000023457 MI0005529 hsa-miR-220b CCACCACCGUGUCUGACACUU
ENSCAFT00000023457 MI0000745 hsa-miR-301a CAGUGCAAUAGUAUUGUCAAAGC
ENSCAFT00000023457 MI0005568 hsa-miR-301b CAGUGCAAUGAUAUUGUCAAAGC
ENSCAFT00000023457 MI0000790 hsa-miR-382 GAAGUUGUUCGUGGUGGAUUCG
ENSCAFT00000023457 MI0001723 hsa-miR-433 AUCAUGAUGGGCUCCUCGGUGU
ENSCAFT00000023457 MI0003820 hsa-miR-454 UAGUGCAAUAUUGCUUAUAGGGU
ENSCAFT00000023457 MI0003144 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENSCAFT00000023457 MI0003147 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENSCAFT00000023457 MI0003169 hsa-miR-518e AAAGCGCUUCCCUUCAGAGUG
ENSCAFT00000023457 MI0003145 hsa-miR-519e AAGUGCCUCCUUUUAGAGUGUU
ENSCAFT00000023457 MI0003143 hsa-miR-520e AAAGUGCUUCCUUUUUGAGGG
ENSCAFT00000023457 MI0003146 hsa-miR-520f AAGUGCUUCCUUUUAGAGGGUU
ENSCAFT00000023457 MI0003589 hsa-miR-582-3p UAACUGGUUGAACAACUGAACC
ENSCAFT00000023457 MI0003666 hsa-miR-651 UUUAGGAUAAGCUUGACUUUUG
ENSCAFT00000023457 MI0005524 hsa-miR-891a UGCAACGAACCUGAGCCACUGA
ENSCAFT00000023457 MI0005713 hsa-miR-921 CUAGUGAGGGACAGAACCAGGAUUC
ENSCAFT00000023457 MI0005758 hsa-miR-936 ACAGUAGAGGGAGGAAUCGCAG
ENSCAFT00000023457 MI0005769 hsa-miR-944 AAAUUAUUGUACAUCGGAUGAG
ENSCAFT00000023457 MI0002402 mmu-miR-467a UAAGUGCCUGCAUGUAUAUGCG
ENSCAFT00000023457 MI0004652 mmu-miR-687 CUAUCCUGGAAUGCAGCAAUGA
ENSCAFT00000023457 MI0004708 mmu-miR-721 CAGUGCAAUUAAAAGGGGGAA
ENSCAFT00000023457 MI0005203 mmu-miR-804 UGUGAGUUGUUCCUCACCUGGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_546544  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene