ABCB11 | GeneID:488390 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 488390 Official Symbol ABCB11
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family B (MDR/TAP), member 11
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 74509

ID Symbol Protein Species
GeneID:8647 ABCB11 NP_003733.2 Homo sapiens
GeneID:27413 Abcb11 NP_066302.2 Mus musculus
GeneID:470717 ABCB11 XP_526100.2 Pan troglodytes
GeneID:488390 ABCB11 XP_545512.2 Canis lupus familiaris
GeneID:531150 ABCB11 XP_609636.3 Bos taurus
GeneID:570936 LOC570936 XP_699562.3 Danio rerio
GeneID:571189 LOC571189 XP_001923538.1 Danio rerio
GeneID:4324720 Os01g0723800 NP_001044110.1 Oryza sativa

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001143932 NP_001137404
2 XM_545512 XP_545512

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000019045 MI0005013 bta-miR-181b AACAUUCAUUGCUGUCGGUGGGUUU
ENSCAFT00000019045 MI0005018 bta-miR-30e-5p UGUAAACAUCCUUGACUGGAAGCU
ENSCAFT00000019045 MI0000450 hsa-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENSCAFT00000019045 MI0000451 hsa-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENSCAFT00000019045 MI0000822 hsa-miR-133b UUUGGUCCCCUUCAACCAGCUA
ENSCAFT00000019045 MI0000273 hsa-miR-183 UAUGGCACUGGUAGAAUUCACU
ENSCAFT00000019045 MI0003184 hsa-miR-500 UAAUCCUUGCUACCUGGGUGAGA
ENSCAFT00000019045 MI0003185 hsa-miR-501-5p AAUCCUUUGUCCCUGGGUGAGA
ENSCAFT00000019045 MI0003196 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENSCAFT00000019045 MI0005530 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENSCAFT00000019045 MI0005717 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENSCAFT00000019045 MI0003170 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENSCAFT00000019045 MI0003173 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENSCAFT00000019045 MI0003146 hsa-miR-520f AAGUGCUUCCUUUUAGAGGGUU
ENSCAFT00000019045 MI0005565 hsa-miR-543 AAACAUUCGCGGUGCACUUCUU
ENSCAFT00000019045 MI0003585 hsa-miR-578 CUUCUUGUGCUCUAGGAUUGU
ENSCAFT00000019045 MI0003586 hsa-miR-579 UUCAUUUGGUAUAAACCGCGAUU
ENSCAFT00000019045 MI0003647 hsa-miR-632 GUGUCUGCUUCCUGUGGGA
ENSCAFT00000019045 MI0003658 hsa-miR-643 ACUUGUAUGCUAGCUCAGGUAG
ENSCAFT00000019045 MI0003667 hsa-miR-652 AAUGGCGCCACUAGGGUUGUG
ENSCAFT00000019045 MI0005538 hsa-miR-892b CACUGGCUCCUUUCUGGGUAGA
ENSCAFT00000019045 MI0005760 hsa-miR-938 UGCCCUUAAAGGUGAACCCAGU
ENSCAFT00000019045 MI0000098 hsa-miR-96 UUUGGCACUAGCACAUUUUUGCU
ENSCAFT00000019045 MI0003539 mmu-miR-291b-3p AAAGUGCAUCCAUUUUGUUUGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene