AADACL1 | GeneID:488171 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 488171 Official Symbol AADACL1
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description arylacetamide deacetylase-like 1
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 23251

ID Symbol Protein Species
GeneID:57552 AADACL1 NP_065843.3 Homo sapiens
GeneID:177791 esterase NP_501702.1 Caenorhabditis elegans
GeneID:181188 esterase NP_001024899.1 Caenorhabditis elegans
GeneID:189866 Y43F8A.3 NP_507771.2 Caenorhabditis elegans
GeneID:320024 Aadacl1 NP_848887.1 Mus musculus
GeneID:429158 AADACL1 XP_426713.2 Gallus gallus
GeneID:432374 zgc:92416 NP_001002303.1 Danio rerio
GeneID:470998 AADACL1 XP_526382.2 Pan troglodytes
GeneID:488171 AADACL1 XP_545295.2 Canis lupus familiaris
GeneID:534212 AADACL1 XP_584246.3 Bos taurus
GeneID:777713 zgc:153038 NP_001071229.1 Danio rerio
GeneID:797436 LOC797436 XP_001335382.1 Danio rerio

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_545295 XP_545295

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000024426 MI0005005 bta-miR-106 AAAAGUGCUUACAGUGCAGGUA
ENSCAFT00000024426 MI0004740 bta-miR-18a UAAGGUGCAUCUAGUGCAGAUA
ENSCAFT00000024426 MI0004732 bta-miR-18b UAAGGUGCAUCUAGUGCAGUUA
ENSCAFT00000024426 MI0005037 bta-miR-200a UAACACUGUCUGGUAACGAUGUU
ENSCAFT00000024426 MI0004741 bta-miR-20a UAAAGUGCUUAUAGUGCAGGUAG
ENSCAFT00000024426 MI0005015 bta-miR-20b CAAAGUGCUCACAGUGCAGGUA
ENSCAFT00000024426 MI0005067 bta-miR-25 CAUUGCACUUGUCUCGGUCUGA
ENSCAFT00000024426 MI0004731 bta-miR-26a UUCAAGUAAUCCAGGAUAGGCU
ENSCAFT00000024426 MI0000457 hsa-miR-141 UAACACUGUCUGGUAAAGAUGG
ENSCAFT00000024426 MI0000816 hsa-miR-335 UCAAGAGCAAUAACGAAAAAUGU
ENSCAFT00000024426 MI0003820 hsa-miR-454 UAGUGCAAUAUUGCUUAUAGGGU
ENSCAFT00000024426 MI0003132 hsa-miR-493 UGAAGGUCUACUGUGUGCCAGG
ENSCAFT00000024426 MI0003194 hsa-miR-507 UUUUGCACCUUUUGGAGUGAA
ENSCAFT00000024426 MI0003165 hsa-miR-517b UCGUGCAUCCCUUUAGAGUGUU
ENSCAFT00000024426 MI0003159 hsa-miR-518c CAAAGCGCUUCUCUUUAGAGUGU
ENSCAFT00000024426 MI0003154 hsa-miR-518f GAAAGCGCUUCUCUUUAGAGG
ENSCAFT00000024426 MI0003178 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENSCAFT00000024426 MI0003182 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENSCAFT00000024426 MI0003151 hsa-miR-519b-3p AAAGUGCAUCCUUUUAGAGGUU
ENSCAFT00000024426 MI0003148 hsa-miR-519c-3p AAAGUGCAUCUUUUUAGAGGAU
ENSCAFT00000024426 MI0003162 hsa-miR-519d CAAAGUGCCUCCCUUUAGAGUG
ENSCAFT00000024426 MI0003164 hsa-miR-520d-3p AAAGUGCUUCUCUUUGGUGGGU
ENSCAFT00000024426 MI0003143 hsa-miR-520e AAAGUGCUUCCUUUUUGAGGG
ENSCAFT00000024426 MI0003166 hsa-miR-520g ACAAAGUGCUUCCCUUUAGAGUGU
ENSCAFT00000024426 MI0003175 hsa-miR-520h ACAAAGUGCUUCCCUUUAGAGU
ENSCAFT00000024426 MI0003599 hsa-miR-589 UGAGAACCACGUCUGCUCUGAG
ENSCAFT00000024426 MI0003609 hsa-miR-597 UGUGUCACUCGAUGACCACUGU
ENSCAFT00000024426 MI0003906 hsa-miR-802 CAGUAACAAAGAUUCAUCCUUGU
ENSCAFT00000024426 MI0005528 hsa-miR-892a CACUGUGUCCUUUCUGCGUAG
ENSCAFT00000024426 MI0005755 hsa-miR-933 UGUGCGCAGGGAGACCUCUCCC
ENSCAFT00000024426 MI0003539 mmu-miR-291b-3p AAAGUGCAUCCAUUUUGUUUGU
ENSCAFT00000024426 MI0003518 mmu-miR-540-5p CAAGGGUCACCCUCUGACUCUGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_545295  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene