ABCG1 | GeneID:487777 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 487777 Official Symbol ABCG1
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family G (WHITE), member 1
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 21022

ID Symbol Protein Species
GeneID:9619 ABCG1 NP_004906.3 Homo sapiens
GeneID:11307 Abcg1 NP_033723.1 Mus musculus
GeneID:33636 Atet NP_001097078.1 Drosophila melanogaster
GeneID:85264 Abcg1 NP_445954.1 Rattus norvegicus
GeneID:178182 wht-5 NP_502352.1 Caenorhabditis elegans
GeneID:190068 wht-9 NP_499616.1 Caenorhabditis elegans
GeneID:418533 ABCG1 XP_416742.2 Gallus gallus
GeneID:458577 ABCG1 XP_514918.2 Pan troglodytes
GeneID:487777 ABCG1 XP_544902.2 Canis lupus familiaris
GeneID:510745 ABCG1 XP_587930.3 Bos taurus
GeneID:556979 zgc:162197 NP_001103924.1 Danio rerio
GeneID:840064 AT1G31770 NP_564383.1 Arabidopsis thaliana
GeneID:1281268 AgaP_AGAP001858 XP_550960.1 Anopheles gambiae
GeneID:4344750 Os08g0167000 NP_001061077.1 Oryza sativa

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_544902 XP_544902

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000016438 MI0000448 hsa-miR-130a CAGUGCAAUGUUAAAAGGGCAU
ENSCAFT00000016438 MI0000748 hsa-miR-130b CAGUGCAAUGAUGAAAGGGCAU
ENSCAFT00000016438 MI0000274 hsa-miR-187 UCGUGUCUUGUGUUGCAGCCGG
ENSCAFT00000016438 MI0001729 hsa-miR-451 AAACCGUUACCAUUACUGAGUU
ENSCAFT00000016438 MI0003610 hsa-miR-598 UACGUCAUCGUUGUCAUCGUCA
ENSCAFT00000016438 MI0003615 hsa-miR-602 GACACGGGCGACAGCUGCGGCCC
ENSCAFT00000016438 MI0003627 hsa-miR-614 GAACGCCUGUUCUUGCCAGGUGG
ENSCAFT00000016438 MI0003628 hsa-miR-615-5p GGGGGUCCCCGGUGCUCGGAUC
ENSCAFT00000016438 MI0003660 hsa-miR-645 UCUAGGCUGGUACUGCUGA
ENSCAFT00000016438 MI0003665 hsa-miR-650 AGGAGGCAGCGCUCUCAGGAC
ENSCAFT00000016438 MI0003676 hsa-miR-654-5p UGGUGGGCCGCAGAACAUGUGC
ENSCAFT00000016438 MI0005524 hsa-miR-891a UGCAACGAACCUGAGCCACUGA
ENSCAFT00000016438 MI0005762 hsa-miR-940 AAGGCAGGGCCCCCGCUCCCC
ENSCAFT00000016438 MI0005763 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENSCAFT00000016438 MI0005764 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENSCAFT00000016438 MI0005765 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENSCAFT00000016438 MI0005766 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENSCAFT00000016438 MI0004196 mmu-miR-667 UGACACCUGCCACCCAGCCCAAG
ENSCAFT00000016438 MI0004699 mmu-miR-714 CGACGAGGGCCGGUCGGUCGC
ENSCAFT00000016438 MI0004310 mmu-miR-764-3p AGGAGGCCAUAGUGGCAACUGU
ENSCAFT00000016438 MI0005548 mmu-miR-878-3p GCAUGACACCACACUGGGUAGA
ENSCAFT00000016438 MI0000613 rno-miR-336 UCACCCUUCCAUAUCUAGUCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_544902  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene