AADACL3 | GeneID:487435 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 487435 Official Symbol AADACL3
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description arylacetamide deacetylase-like 3
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 28426

ID Symbol Protein Species
GeneID:126767 AADACL3 NP_001096640.1 Homo sapiens
GeneID:230883 Aadacl3 XP_144109.1 Mus musculus
GeneID:313686 Aadacl3 XP_233636.4 Rattus norvegicus
GeneID:457970 AADACL3 XP_514407.2 Pan troglodytes
GeneID:487435 AADACL3 XP_544560.2 Canis lupus familiaris
GeneID:530613 AADACL3 XP_609088.2 Bos taurus

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_544560 XP_544560

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000025956 MI0004761 bta-miR-30b UGUAAACAUCCUACACUCAGCU
ENSCAFT00000025956 MI0005064 bta-miR-30c UGUAAACAUCCUACACUCUCAGC
ENSCAFT00000025956 MI0004998 gga-miR-460 CCUGCAUUGUACACACUGUGUG
ENSCAFT00000025956 MI0000301 hsa-miR-224 CAAGUCACUAGUGGUUCCGUU
ENSCAFT00000025956 MI0000778 hsa-miR-370 GCCUGCUGGGGUGGAACCUGGU
ENSCAFT00000025956 MI0000779 hsa-miR-371-3p AAGUGCCGCCAUCUUUUGAGUGU
ENSCAFT00000025956 MI0003125 hsa-miR-490-3p CAACCUGGAGGACUCCAUGCUG
ENSCAFT00000025956 MI0003131 hsa-miR-492 AGGACCUGCGGGACAAGAUUCUU
ENSCAFT00000025956 MI0003559 hsa-miR-554 GCUAGUCCUGACUCAGCCAGU
ENSCAFT00000025956 MI0003664 hsa-miR-649 AAACCUGUGUUGUUCAAGAGUC
ENSCAFT00000025956 MI0005562 hsa-miR-887 GUGAACGGGCGCCAUCCCGAGG
ENSCAFT00000025956 MI0005768 hsa-miR-943 CUGACUGUUGCCGUCCUCCAG
ENSCAFT00000025956 MI0005494 mmu-miR-343 UCUCCCUUCAUGUGCCCAGA
ENSCAFT00000025956 MI0005507 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENSCAFT00000025956 MI0005508 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENSCAFT00000025956 MI0005509 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENSCAFT00000025956 MI0004553 mmu-miR-666-3p GGCUGCAGCGUGAUCGCCUGCU
ENSCAFT00000025956 MI0004310 mmu-miR-764-3p AGGAGGCCAUAGUGGCAACUGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_544560  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]