A3GALT2 | GeneID:487298 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 487298 Official Symbol A3GALT2
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description alpha 1,3-galactosyltransferase 2
Chromosome N/A
Also Known As alpha 1,3-galactosyltransferase 2 (isoglobotriaosylceramide synthase)
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 16326

ID Symbol Protein Species
GeneID:127550 A3GALT2 NP_001073907.1 Homo sapiens
GeneID:171553 A3galt2 NP_612533.1 Rattus norvegicus
GeneID:215493 A3galt2 NP_001009819.1 Mus musculus
GeneID:487298 A3GALT2 XP_544424.2 Canis lupus familiaris

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_544424 XP_544424

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000016490 MI0005008 bta-miR-127 UCGGAUCCGUCUGAGCUUGGCU
ENSCAFT00000016490 MI0005031 bta-miR-17-3p ACUGCAGUGAAGGCACUUGU
ENSCAFT00000016490 MI0000454 hsa-miR-137 UUAUUGCUUAAGAAUACGCGUAG
ENSCAFT00000016490 MI0000238 hsa-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENSCAFT00000016490 MI0000279 hsa-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENSCAFT00000016490 MI0001150 hsa-miR-196b UAGGUAGUUUCCUGUUGUUGGG
ENSCAFT00000016490 MI0000296 hsa-miR-219-5p UGAUUGUCCAAACGCAAUUCU
ENSCAFT00000016490 MI0000740 hsa-miR-219-5p UGAUUGUCCAAACGCAAUUCU
ENSCAFT00000016490 MI0000806 hsa-miR-337-5p GAACGGCUUCAUACAGGAGUU
ENSCAFT00000016490 MI0003123 hsa-miR-488 UUGAAAGGCUAUUUCUUGGUC
ENSCAFT00000016490 MI0003559 hsa-miR-554 GCUAGUCCUGACUCAGCCAGU
ENSCAFT00000016490 MI0003674 hsa-miR-653 GUGUUGAAACAAUCUCUACUG
ENSCAFT00000016490 MI0000391 mmu-miR-293 AGUGCCGCAGAGUUUGUAGUGU
ENSCAFT00000016490 MI0005493 mmu-miR-327 ACUUGAGGGGCAUGAGGAU
ENSCAFT00000016490 MI0000625 mmu-miR-341 UCGGUCGAUCGGUCGGUCGGU
ENSCAFT00000016490 MI0002399 mmu-miR-464 UACCAAGUUUAUUCUGUGAGAUA
ENSCAFT00000016490 MI0004666 mmu-miR-669b AGUUUUGUGUGCAUGUGCAUGU
ENSCAFT00000016490 MI0005477 mmu-miR-883b-5p UACUGAGAAUGGGUAGCAGUCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_544424  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]