ABCC9 | GeneID:486638 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 486638 Official Symbol ABCC9
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family C (CFTR/MRP), member 9
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 56521

ID Symbol Protein Species
GeneID:10060 ABCC9 NP_064693.2 Homo sapiens
GeneID:20928 Abcc9 NP_035641.1 Mus musculus
GeneID:25560 Abcc9 NP_037172.2 Rattus norvegicus
GeneID:34350 Sur NP_477472.1 Drosophila melanogaster
GeneID:465338 ABCC9 XP_001149571.1 Pan troglodytes
GeneID:486638 ABCC9 XP_852746.1 Canis lupus familiaris
GeneID:522913 ABCC9 XP_601202.3 Bos taurus
GeneID:561160 abcc9 NP_001025325.1 Danio rerio

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_543765 XP_543765
2 XM_847653 XP_852746
3 XM_861178 XP_866271
4 XM_861193 XP_866286

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000019308 MI0004758 bta-miR-199a-3p ACAGUAGUCUGCACAUUGGUUA
ENSCAFT00000019308 MI0001640 cfa-miR-448 UUGCAUAUGUAGGAUGUCCCAU
ENSCAFT00000019308 MI0004998 gga-miR-460 CCUGCAUUGUACACACUGUGUG
ENSCAFT00000019308 MI0000480 hsa-miR-154 UAGGUUAUCCGUGUUGCCUUCG
ENSCAFT00000019308 MI0003130 hsa-miR-202 AGAGGUAUAGGGCAUGGGAA
ENSCAFT00000019308 MI0000745 hsa-miR-301a CAGUGCAAUAGUAUUGUCAAAGC
ENSCAFT00000019308 MI0000786 hsa-miR-378 ACUGGACUUGGAGUCAGAAGG
ENSCAFT00000019308 MI0001444 hsa-miR-422a ACUGGACUUAGGGUCAGAAGGC
ENSCAFT00000019308 MI0003820 hsa-miR-454 UAGUGCAAUAUUGCUUAUAGGGU
ENSCAFT00000019308 MI0003124 hsa-miR-489 GUGACAUCACAUAUACGGCAGC
ENSCAFT00000019308 MI0003125 hsa-miR-490-5p CCAUGGAUCUCCAGGUGGGU
ENSCAFT00000019308 MI0003132 hsa-miR-493 UGAAGGUCUACUGUGUGCCAGG
ENSCAFT00000019308 MI0003514 hsa-miR-539 GGAGAAAUUAUCCUUGGUGUGU
ENSCAFT00000019308 MI0003568 hsa-miR-562 AAAGUAGCUGUACCAUUUGC
ENSCAFT00000019308 MI0003573 hsa-miR-567 AGUAUGUUCUUCCAGGACAGAAC
ENSCAFT00000019308 MI0003580 hsa-miR-573 CUGAAGUGAUGUGUAACUGAUCAG
ENSCAFT00000019308 MI0003602 hsa-miR-590-3p UAAUUUUAUGUAUAAGCUAGU
ENSCAFT00000019308 MI0003603 hsa-miR-591 AGACCAUGGGUUCUCAUUGU
ENSCAFT00000019308 MI0003629 hsa-miR-616 AGUCAUUGGAGGGUUUGAGCAG
ENSCAFT00000019308 MI0003631 hsa-miR-617 AGACUUCCCAUUUGAAGGUGGC
ENSCAFT00000019308 MI0003636 hsa-miR-622 ACAGUCUGCUGAGGUUGGAGC
ENSCAFT00000019308 MI0003655 hsa-miR-640 AUGAUCCAGGAACCUGCCUCU
ENSCAFT00000019308 MI0005476 mmu-miR-883a-3p UAACUGCAACAGCUCUCAGUAU
ENSCAFT00000019308 MI0005477 mmu-miR-883b-3p UAACUGCAACAUCUCUCAGUAU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene