AACS | GeneID:486240 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 486240 Official Symbol AACS
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description acetoacetyl-CoA synthetase
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 11322

ID Symbol Protein Species
GeneID:65984 Aacs NP_075592.1 Rattus norvegicus
GeneID:65985 AACS NP_076417.2 Homo sapiens
GeneID:78894 Aacs NP_084486.1 Mus musculus
GeneID:180992 sur-5 NP_509229.1 Caenorhabditis elegans
GeneID:393984 aacs NP_957303.1 Danio rerio
GeneID:416811 AACS NP_001006184.1 Gallus gallus
GeneID:452361 AACS XP_001135709.1 Pan troglodytes
GeneID:486240 AACS XP_543365.2 Canis lupus familiaris
GeneID:505842 AACS XP_582199.3 Bos taurus
GeneID:2675470 MGG_05196 XP_359581.2 Magnaporthe grisea
GeneID:2704372 NCU00446.1 XP_322532.1 Neurospora crassa

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_543365 XP_543365

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000011130 MI0005008 bta-miR-127 UCGGAUCCGUCUGAGCUUGGCU
ENSCAFT00000011130 MI0004737 bta-miR-148a UCAGUGCACUACAGAACUUUGU
ENSCAFT00000011130 MI0005030 bta-miR-148b UCAGUGCAUCACAGAACUUUGU
ENSCAFT00000011130 MI0005031 bta-miR-17-5p CAAAGUGCUUACAGUGCAGGUAGU
ENSCAFT00000011130 MI0005460 bta-miR-19a UGUGCAAAUCUAUGCAAAACUGA
ENSCAFT00000011130 MI0005461 bta-miR-19b UGUGCAAAUCCAUGCAAAACUGA
ENSCAFT00000011130 MI0004762 bta-miR-31 AGGCAAGAUGCUGGCAUAGCU
ENSCAFT00000011130 MI0005463 bta-miR-331 GCCCCUGGGCCUAUCCUAGAA
ENSCAFT00000011130 MI0005019 bta-miR-345 GCUGACUCCUAGUCCAGUGCU
ENSCAFT00000011130 MI0005464 bta-miR-34a UGGCAGUGUCUUAGCUGGUUGU
ENSCAFT00000011130 MI0005068 bta-miR-34c AGGCAGUGUAGUUAGCUGAUUG
ENSCAFT00000011130 MI0001651 cfa-miR-449 UGGCAGUGUAUUGUUAGCUGGU
ENSCAFT00000011130 MI0004999 gga-miR-757 GCAGAGCUGCAGAUGGGAUUC
ENSCAFT00000011130 MI0005000 gga-miR-757 GCAGAGCUGCAGAUGGGAUUC
ENSCAFT00000011130 MI0000111 hsa-miR-105 UCAAAUGCUCAGACUCCUGUGGU
ENSCAFT00000011130 MI0000112 hsa-miR-105 UCAAAUGCUCAGACUCCUGUGGU
ENSCAFT00000011130 MI0005544 hsa-miR-147b GUGUGCGGAAAUGCUUCUGCUA
ENSCAFT00000011130 MI0000462 hsa-miR-152 UCAGUGCAUGACAGAACUUGG
ENSCAFT00000011130 MI0000745 hsa-miR-301a CAGUGCAAUAGUAUUGUCAAAGC
ENSCAFT00000011130 MI0005568 hsa-miR-301b CAGUGCAAUGAUAUUGUCAAAGC
ENSCAFT00000011130 MI0000738 hsa-miR-302a UAAGUGCUUCCAUGUUUUGGUGA
ENSCAFT00000011130 MI0001725 hsa-miR-329 AACACACCUGGUUAACCUCUUU
ENSCAFT00000011130 MI0001726 hsa-miR-329 AACACACCUGGUUAACCUCUUU
ENSCAFT00000011130 MI0000762 hsa-miR-362-3p AACACACCUAUUCAAGGAUUCA
ENSCAFT00000011130 MI0000776 hsa-miR-376c AACAUAGAGGAAAUUCCACGU
ENSCAFT00000011130 MI0001729 hsa-miR-451 AAACCGUUACCAUUACUGAGUU
ENSCAFT00000011130 MI0003132 hsa-miR-493 UGAAGGUCUACUGUGUGCCAGG
ENSCAFT00000011130 MI0003190 hsa-miR-505 CGUCAACACUUGCUGGUUUCCU
ENSCAFT00000011130 MI0003195 hsa-miR-508-5p UACUCCAGAGGGCGUCACUCAUG
ENSCAFT00000011130 MI0003144 hsa-miR-515-5p UUCUCCAAAAGAAAGCACUUUCUG
ENSCAFT00000011130 MI0003147 hsa-miR-515-5p UUCUCCAAAAGAAAGCACUUUCUG
ENSCAFT00000011130 MI0003170 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENSCAFT00000011130 MI0003173 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENSCAFT00000011130 MI0003149 hsa-miR-520a-3p AAAGUGCUUCCCUUUGGACUGU
ENSCAFT00000011130 MI0003149 hsa-miR-520a-5p CUCCAGAGGGAAGUACUUUCU
ENSCAFT00000011130 MI0003155 hsa-miR-520b AAAGUGCUUCCUUUUAGAGGG
ENSCAFT00000011130 MI0003158 hsa-miR-520c-3p AAAGUGCUUCCUUUUAGAGGGU
ENSCAFT00000011130 MI0003164 hsa-miR-520d-3p AAAGUGCUUCUCUUUGGUGGGU
ENSCAFT00000011130 MI0003143 hsa-miR-520e AAAGUGCUUCCUUUUUGAGGG
ENSCAFT00000011130 MI0003146 hsa-miR-520f AAGUGCUUCCUUUUAGAGGGUU
ENSCAFT00000011130 MI0003597 hsa-miR-588 UUGGCCACAAUGGGUUAGAAC
ENSCAFT00000011130 MI0003607 hsa-miR-595 GAAGUGUGCCGUGGUGUGUCU
ENSCAFT00000011130 MI0003615 hsa-miR-602 GACACGGGCGACAGCUGCGGCCC
ENSCAFT00000011130 MI0003616 hsa-miR-603 CACACACUGCAAUUACUUUUGC
ENSCAFT00000011130 MI0003656 hsa-miR-641 AAAGACAUAGGAUAGAGUCACCUC
ENSCAFT00000011130 MI0003757 hsa-miR-758 UUUGUGACCUGGUCCACUAACC
ENSCAFT00000011130 MI0000389 mmu-miR-291a-3p AAAGUGCUUCCACUUUGUGUGC
ENSCAFT00000011130 MI0000391 mmu-miR-293 AGUGCCGCAGAGUUUGUAGUGU
ENSCAFT00000011130 MI0000392 mmu-miR-294 AAAGUGCUUCCCUUUUGUGUGU
ENSCAFT00000011130 MI0005507 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSCAFT00000011130 MI0005508 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSCAFT00000011130 MI0005509 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSCAFT00000011130 MI0005511 mmu-miR-466h UGUGUGCAUGUGCUUGUGUGUA
ENSCAFT00000011130 MI0003518 mmu-miR-540-3p AGGUCAGAGGUCGAUCCUGG
ENSCAFT00000011130 MI0004295 mmu-miR-670 AUCCCUGAGUGUAUGUGGUGAA
ENSCAFT00000011130 MI0005003 mmu-miR-676 CCGUCCUGAGGUUGUUGAGCU
ENSCAFT00000011130 MI0005205 mmu-miR-741 UGAGAGAUGCCAUUCUAUGUAGA
ENSCAFT00000011130 MI0004554 mmu-miR-759 GCAGAGUGCAAACAAUUUUGAC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_543365  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene