AADAT | GeneID:486059 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 486059 Official Symbol AADAT
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description aminoadipate aminotransferase
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 56540

ID Symbol Protein Species
GeneID:23923 Aadat NP_035964.1 Mus musculus
GeneID:29416 Aadat NP_058889.1 Rattus norvegicus
GeneID:51166 AADAT NP_057312.1 Homo sapiens
GeneID:428728 AADAT XP_426286.2 Gallus gallus
GeneID:461601 AADAT XP_001154960.1 Pan troglodytes
GeneID:486059 AADAT XP_543185.2 Canis lupus familiaris
GeneID:508929 AADAT NP_001015551.1 Bos taurus
GeneID:520638 LOC520638 XP_598886.3 Bos taurus
GeneID:557979 LOC557979 XP_686234.3 Danio rerio
GeneID:5048716 MGG_14221 XP_001402824.1 Magnaporthe grisea

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_543185 XP_543185

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000012298 MI0005045 bta-miR-361 UUAUCAGAAUCUCCAGGGGUAC
ENSCAFT00000012298 MI0001647 cfa-miR-365 UAAUGCCCCUAAAAAUCCUUAU
ENSCAFT00000012298 MI0001657 cfa-miR-365 UAAUGCCCCUAAAAAUCCUUAU
ENSCAFT00000012298 MI0000252 hsa-miR-129-5p CUUUUUGCGGUCUGGGCUUGC
ENSCAFT00000012298 MI0000473 hsa-miR-129-5p CUUUUUGCGGUCUGGGCUUGC
ENSCAFT00000012298 MI0000454 hsa-miR-137 UUAUUGCUUAAGAAUACGCGUAG
ENSCAFT00000012298 MI0000681 hsa-miR-155 UUAAUGCUAAUCGUGAUAGGGGU
ENSCAFT00000012298 MI0003130 hsa-miR-202 AGAGGUAUAGGGCAUGGGAA
ENSCAFT00000012298 MI0005570 hsa-miR-208b AUAAGACGAACAAAAGGUUUGU
ENSCAFT00000012298 MI0000296 hsa-miR-219-5p UGAUUGUCCAAACGCAAUUCU
ENSCAFT00000012298 MI0000740 hsa-miR-219-5p UGAUUGUCCAAACGCAAUUCU
ENSCAFT00000012298 MI0000802 hsa-miR-340 UUAUAAAGCAAUGAGACUGAUU
ENSCAFT00000012298 MI0000776 hsa-miR-376c AACAUAGAGGAAAUUCCACGU
ENSCAFT00000012298 MI0000790 hsa-miR-382 GAAGUUGUUCGUGGUGGAUUCG
ENSCAFT00000012298 MI0000791 hsa-miR-383 AGAUCAGAAGGUGAUUGUGGCU
ENSCAFT00000012298 MI0003134 hsa-miR-494 UGAAACAUACACGGGAAACCUC
ENSCAFT00000012298 MI0003195 hsa-miR-508-3p UGAUUGUAGCCUUUUGGAGUAGA
ENSCAFT00000012298 MI0005717 hsa-miR-509-3-5p UACUGCAGACGUGGCAAUCAUG
ENSCAFT00000012298 MI0003196 hsa-miR-509-5p UACUGCAGACAGUGGCAAUCA
ENSCAFT00000012298 MI0005530 hsa-miR-509-5p UACUGCAGACAGUGGCAAUCA
ENSCAFT00000012298 MI0003166 hsa-miR-520g ACAAAGUGCUUCCCUUUAGAGUGU
ENSCAFT00000012298 MI0003175 hsa-miR-520h ACAAAGUGCUUCCCUUUAGAGU
ENSCAFT00000012298 MI0003177 hsa-miR-522 AAAAUGGUUCCCUUUAGAGUGU
ENSCAFT00000012298 MI0003612 hsa-miR-548a-5p AAAAGUAAUUGCGAGUUUUACC
ENSCAFT00000012298 MI0003596 hsa-miR-548b-5p AAAAGUAAUUGUGGUUUUGGCC
ENSCAFT00000012298 MI0003630 hsa-miR-548c-3p CAAAAAUCUCAAUUACUUUUGC
ENSCAFT00000012298 MI0003630 hsa-miR-548c-5p AAAAGUAAUUGCGGUUUUUGCC
ENSCAFT00000012298 MI0003668 hsa-miR-548d-5p AAAAGUAAUUGUGGUUUUUGCC
ENSCAFT00000012298 MI0003671 hsa-miR-548d-5p AAAAGUAAUUGUGGUUUUUGCC
ENSCAFT00000012298 MI0003567 hsa-miR-561 CAAAGUUUAAGAUCCUUGAAGU
ENSCAFT00000012298 MI0003620 hsa-miR-607 GUUCAAAUCCAGAUCUAUAAC
ENSCAFT00000012298 MI0003636 hsa-miR-622 ACAGUCUGCUGAGGUUGGAGC
ENSCAFT00000012298 MI0003656 hsa-miR-641 AAAGACAUAGGAUAGAGUCACCUC
ENSCAFT00000012298 MI0003674 hsa-miR-653 GUGUUGAAACAAUCUCUACUG
ENSCAFT00000012298 MI0005510 mmu-miR-466g AUACAGACACAUGCACACACA
ENSCAFT00000012298 MI0004664 mmu-miR-694 CUGAAAAUGUUGCCUGAAG
ENSCAFT00000012298 MI0004554 mmu-miR-759 GCAGAGUGCAAACAAUUUUGAC
ENSCAFT00000012298 MI0005548 mmu-miR-878-3p GCAUGACACCACACUGGGUAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_543185  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]