A4GNT | GeneID:485683 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 485683 Official Symbol A4GNT
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description alpha-1,4-N-acetylglucosaminyltransferase
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 87446

ID Symbol Protein Species
GeneID:51146 A4GNT NP_057245.1 Homo sapiens
GeneID:333424 A4gnt NP_001070892.1 Mus musculus
GeneID:429136 A4GNT XP_426692.2 Gallus gallus
GeneID:460724 A4GNT XP_516775.2 Pan troglodytes
GeneID:485683 A4GNT XP_542803.2 Canis lupus familiaris
GeneID:540795 A4GNT XP_613170.1 Bos taurus
GeneID:685758 A4gnt XP_001065156.1 Rattus norvegicus

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_542803 XP_542803

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000012023 MI0005459 bta-miR-195 UAGCAGCACAGAAAUAUUGGCA
ENSCAFT00000012023 MI0004758 bta-miR-199a-3p ACAGUAGUCUGCACAUUGGUUA
ENSCAFT00000012023 MI0004743 bta-miR-221 AGCUACAUUGUCUGCUGGGUUU
ENSCAFT00000012023 MI0004744 bta-miR-222 AGCUACAUCUGGCUACUGGGU
ENSCAFT00000012023 MI0005020 bta-miR-369-5p AUCGACCGUGUUAUAUUCGC
ENSCAFT00000012023 MI0005060 bta-miR-487b AAUCGUACAGGGUCAUCCACUU
ENSCAFT00000012023 MI0005467 bta-miR-497 CAGCAGCACACUGUGGUUUGUA
ENSCAFT00000012023 MI0001446 hsa-miR-424 CAGCAGCAAUUCAUGUUUUGAA
ENSCAFT00000012023 MI0003132 hsa-miR-493 UGAAGGUCUACUGUGUGCCAGG
ENSCAFT00000012023 MI0003184 hsa-miR-500 UAAUCCUUGCUACCUGGGUGAGA
ENSCAFT00000012023 MI0003195 hsa-miR-508-3p UGAUUGUAGCCUUUUGGAGUAGA
ENSCAFT00000012023 MI0005717 hsa-miR-509-3-5p UACUGCAGACGUGGCAAUCAUG
ENSCAFT00000012023 MI0003196 hsa-miR-509-5p UACUGCAGACAGUGGCAAUCA
ENSCAFT00000012023 MI0005530 hsa-miR-509-5p UACUGCAGACAGUGGCAAUCA
ENSCAFT00000012023 MI0003514 hsa-miR-539 GGAGAAAUUAUCCUUGGUGUGU
ENSCAFT00000012023 MI0003686 hsa-miR-542-3p UGUGACAGAUUGAUAACUGAAA
ENSCAFT00000012023 MI0003603 hsa-miR-591 AGACCAUGGGUUCUCAUUGU
ENSCAFT00000012023 MI0003637 hsa-miR-623 AUCCCUUGCAGGGGCUGUUGGGU
ENSCAFT00000012023 MI0003676 hsa-miR-654-5p UGGUGGGCCGCAGAACAUGUGC
ENSCAFT00000012023 MI0005524 hsa-miR-891a UGCAACGAACCUGAGCCACUGA
ENSCAFT00000012023 MI0005534 hsa-miR-891b UGCAACUUACCUGAGUCAUUGA
ENSCAFT00000012023 MI0000590 mmu-miR-322 CAGCAGCAAUUCAUGUUUUGGA
ENSCAFT00000012023 MI0005510 mmu-miR-466g AUACAGACACAUGCACACACA
ENSCAFT00000012023 MI0004704 mmu-miR-717 CUCAGACAGAGAUACCUUCUCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_542803  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]