ABHD5 | GeneID:485570 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 485570 Official Symbol ABHD5
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description abhydrolase domain containing 5
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 41088

ID Symbol Protein Species
GeneID:51099 ABHD5 NP_057090.2 Homo sapiens
GeneID:67469 Abhd5 NP_080455.1 Mus musculus
GeneID:316122 Abhd5 NP_997689.1 Rattus norvegicus
GeneID:460303 ABHD5 XP_516397.2 Pan troglodytes
GeneID:485570 ABHD5 XP_542689.2 Canis lupus familiaris
GeneID:535588 ABHD5 NP_001069531.1 Bos taurus
GeneID:566493 abhd5 XP_694855.2 Danio rerio

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_542689 XP_542689
2 XM_851834 XP_856927

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000007184 MI0005069 bta-miR-363 AUUGCACGGUAUCCAUCUGCG
ENSCAFT00000007184 MI0004749 bta-miR-484 UCAGGCUCAGUCCCCUCCCGAU
ENSCAFT00000007184 MI0004998 gga-miR-460 CCUGCAUUGUACACACUGUGUG
ENSCAFT00000007184 MI0000454 hsa-miR-137 UUAUUGCUUAAGAAUACGCGUAG
ENSCAFT00000007184 MI0000460 hsa-miR-144 UACAGUAUAGAUGAUGUACU
ENSCAFT00000007184 MI0000484 hsa-miR-188-3p CUCCCACAUGCAGGGUUUGCA
ENSCAFT00000007184 MI0000300 hsa-miR-223 UGUCAGUUUGUCAAAUACCCCA
ENSCAFT00000007184 MI0003514 hsa-miR-539 GGAGAAAUUAUCCUUGGUGUGU
ENSCAFT00000007184 MI0003604 hsa-miR-592 UUGUGUCAAUAUGCGAUGAUGU
ENSCAFT00000007184 MI0003611 hsa-miR-599 GUUGUGUCAGUUUAUCAAAC
ENSCAFT00000007184 MI0003636 hsa-miR-622 ACAGUCUGCUGAGGUUGGAGC
ENSCAFT00000007184 MI0003644 hsa-miR-630 AGUAUUCUGUACCAGGGAAGGU
ENSCAFT00000007184 MI0003681 hsa-miR-657 GGCAGGUUCUCACCCUCUCUAGG
ENSCAFT00000007184 MI0005564 hsa-miR-873 GCAGGAACUUGUGAGUCUCCU
ENSCAFT00000007184 MI0004690 mmu-miR-706 AGAGAAACCCUGUCUCAAAAAA
ENSCAFT00000007184 MI0005476 mmu-miR-883a-5p UGCUGAGAGAAGUAGCAGUUAC
ENSCAFT00000007184 MI0005477 mmu-miR-883b-5p UACUGAGAAUGGGUAGCAGUCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene