A2LD1 | GeneID:485534 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 485534 Official Symbol A2LD1
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description AIG2-like domain 1
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 15522

ID Symbol Protein Species
GeneID:37989 Tina-1 NP_611983.2 Drosophila melanogaster
GeneID:87769 A2LD1 XP_001714550.1 Homo sapiens
GeneID:223267 a2ld1 NP_663441.1 Mus musculus
GeneID:290500 A2ld1 NP_001020805.1 Rattus norvegicus
GeneID:418773 A2LD1 XP_416969.1 Gallus gallus
GeneID:447805 zgc:92115 NP_001004544.1 Danio rerio
GeneID:485534 A2LD1 XP_542653.2 Canis lupus familiaris
GeneID:777609 zgc:154024 NP_001071185.1 Danio rerio
GeneID:100038780 zgc:162208 NP_001083029.1 Danio rerio

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_542653 XP_542653

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000009438 MI0005458 bta-miR-15a UAGCAGCACAUAAUGGUUUGU
ENSCAFT00000009438 MI0005031 bta-miR-17-5p CAAAGUGCUUACAGUGCAGGUAGU
ENSCAFT00000009438 MI0005459 bta-miR-195 UAGCAGCACAGAAAUAUUGGCA
ENSCAFT00000009438 MI0005015 bta-miR-20b CAAAGUGCUCACAGUGCAGGUA
ENSCAFT00000009438 MI0000484 hsa-miR-188-3p CUCCCACAUGCAGGGUUUGCA
ENSCAFT00000009438 MI0000744 hsa-miR-299-5p UGGUUUACCGUCCCACAUACAU
ENSCAFT00000009438 MI0001446 hsa-miR-424 CAGCAGCAAUUCAUGUUUUGAA
ENSCAFT00000009438 MI0003142 hsa-miR-498 UUUCAAGCCAGGGGGCGUUUUUC
ENSCAFT00000009438 MI0003170 hsa-miR-518a-3p GAAAGCGCUUCCCUUUGCUGGA
ENSCAFT00000009438 MI0003173 hsa-miR-518a-3p GAAAGCGCUUCCCUUUGCUGGA
ENSCAFT00000009438 MI0003156 hsa-miR-518b CAAAGCGCUCCCCUUUAGAGGU
ENSCAFT00000009438 MI0003159 hsa-miR-518c CAAAGCGCUUCUCUUUAGAGUGU
ENSCAFT00000009438 MI0003171 hsa-miR-518d-3p CAAAGCGCUUCCCUUUGGAGC
ENSCAFT00000009438 MI0003169 hsa-miR-518e AAAGCGCUUCCCUUCAGAGUG
ENSCAFT00000009438 MI0003154 hsa-miR-518f GAAAGCGCUUCUCUUUAGAGG
ENSCAFT00000009438 MI0003155 hsa-miR-520b AAAGUGCUUCCUUUUAGAGGG
ENSCAFT00000009438 MI0003158 hsa-miR-520c-3p AAAGUGCUUCCUUUUAGAGGGU
ENSCAFT00000009438 MI0003166 hsa-miR-520g ACAAAGUGCUUCCCUUUAGAGUGU
ENSCAFT00000009438 MI0003175 hsa-miR-520h ACAAAGUGCUUCCCUUUAGAGU
ENSCAFT00000009438 MI0003153 hsa-miR-523 GAACGCGCUUCCCUAUAGAGGGU
ENSCAFT00000009438 MI0003686 hsa-miR-542-3p UGUGACAGAUUGAUAACUGAAA
ENSCAFT00000009438 MI0003638 hsa-miR-624 CACAAGGUAUUGGUAUUACCU
ENSCAFT00000009438 MI0005524 hsa-miR-891a UGCAACGAACCUGAGCCACUGA
ENSCAFT00000009438 MI0000590 mmu-miR-322 CAGCAGCAAUUCAUGUUUUGGA
ENSCAFT00000009438 MI0000640 mmu-miR-350 UUCACAAAGCCCAUACACUUUC
ENSCAFT00000009438 MI0002400 mmu-miR-465a-3p GAUCAGGGCCUUUCUAAGUAGA
ENSCAFT00000009438 MI0005511 mmu-miR-466h UGUGUGCAUGUGCUUGUGUGUA
ENSCAFT00000009438 MI0002405 mmu-miR-470 UUCUUGGACUGGCACUGGUGAGU
ENSCAFT00000009438 MI0004601 mmu-miR-673-3p UCCGGGGCUGAGUUCUGUGCACC
ENSCAFT00000009438 MI0004659 mmu-miR-691 AUUCCUGAAGAGAGGCAGAAAA
ENSCAFT00000009438 MI0004678 mmu-miR-720 AUCUCGCUGGGGCCUCCA
ENSCAFT00000009438 MI0005548 mmu-miR-878-5p UAUCUAGUUGGAUGUCAAGACA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_542653  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene