ABCC4 | GeneID:485523 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 485523 Official Symbol ABCC4
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family C (CFTR/MRP), member 4
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 74563

ID Symbol Protein Species
GeneID:10257 ABCC4 NP_005836.2 Homo sapiens
GeneID:35163 CG31792 NP_724148.1 Drosophila melanogaster
GeneID:47905 l(2)03659 NP_610482.2 Drosophila melanogaster
GeneID:170924 Abcc4 NP_596902.1 Rattus norvegicus
GeneID:180691 mrp-6 NP_508710.2 Caenorhabditis elegans
GeneID:239273 Abcc4 NP_001028508.1 Mus musculus
GeneID:368620 abcc4 NP_001007039.1 Danio rerio
GeneID:418791 ABCC4 NP_001025990.1 Gallus gallus
GeneID:452625 ABCC4 XP_001137006.1 Pan troglodytes
GeneID:485523 ABCC4 XP_542642.2 Canis lupus familiaris
GeneID:515333 ABCC4 XP_593336.2 Bos taurus
GeneID:820496 ATMRP3 NP_187915.1 Arabidopsis thaliana
GeneID:820497 ATMRP8 NP_187916.3 Arabidopsis thaliana
GeneID:820498 ATMRP7 NP_187917.3 Arabidopsis thaliana
GeneID:4327122 Os01g0173900 NP_001042159.1 Oryza sativa

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_542642 XP_542642

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000008769 MI0005027 bta-miR-124a UUAAGGCACGCGGUGAAUGCCAA
ENSCAFT00000008769 MI0005029 bta-miR-138 AGCUGGUGUUGUGAAUCAGGCCG
ENSCAFT00000008769 MI0004738 bta-miR-151 CUAGACUGAAGCUCCUUGAGG
ENSCAFT00000008769 MI0005460 bta-miR-19a UGUGCAAAUCUAUGCAAAACUGA
ENSCAFT00000008769 MI0005461 bta-miR-19b UGUGCAAAUCCAUGCAAAACUGA
ENSCAFT00000008769 MI0004741 bta-miR-20a UAAAGUGCUUAUAGUGCAGGUAG
ENSCAFT00000008769 MI0005021 bta-miR-380-3p UAUGUAAUGUGGUCCACGUCU
ENSCAFT00000008769 MI0005061 bta-miR-532 CAUGCCUUGAGUGUAGGACCGU
ENSCAFT00000008769 MI0005050 bta-miR-93 CAAAGUGCUGUUCGUGCAGGUA
ENSCAFT00000008769 MI0000448 hsa-miR-130a CAGUGCAAUGUUAAAAGGGCAU
ENSCAFT00000008769 MI0000748 hsa-miR-130b CAGUGCAAUGAUGAAAGGGCAU
ENSCAFT00000008769 MI0000262 hsa-miR-147 GUGUGUGGAAAUGCUUCUGC
ENSCAFT00000008769 MI0000462 hsa-miR-152 UCAGUGCAUGACAGAACUUGG
ENSCAFT00000008769 MI0000463 hsa-miR-153 UUGCAUAGUCACAAAAGUGAUC
ENSCAFT00000008769 MI0000464 hsa-miR-153 UUGCAUAGUCACAAAAGUGAUC
ENSCAFT00000008769 MI0000288 hsa-miR-212 UAACAGUCUCCAGUCACGGCC
ENSCAFT00000008769 MI0000745 hsa-miR-301a CAGUGCAAUAGUAUUGUCAAAGC
ENSCAFT00000008769 MI0005568 hsa-miR-301b CAGUGCAAUGAUAUUGUCAAAGC
ENSCAFT00000008769 MI0003820 hsa-miR-454 UAGUGCAAUAUUGCUUAUAGGGU
ENSCAFT00000008769 MI0003125 hsa-miR-490-3p CAACCUGGAGGACUCCAUGCUG
ENSCAFT00000008769 MI0003186 hsa-miR-502-3p AAUGCACCUGGGCAAGGAUUCA
ENSCAFT00000008769 MI0003190 hsa-miR-505 CGUCAACACUUGCUGGUUUCCU
ENSCAFT00000008769 MI0003193 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
ENSCAFT00000008769 MI0003612 hsa-miR-548a-5p AAAAGUAAUUGCGAGUUUUACC
ENSCAFT00000008769 MI0003596 hsa-miR-548b-5p AAAAGUAAUUGUGGUUUUGGCC
ENSCAFT00000008769 MI0003630 hsa-miR-548c-3p CAAAAAUCUCAAUUACUUUUGC
ENSCAFT00000008769 MI0003630 hsa-miR-548c-5p AAAAGUAAUUGCGGUUUUUGCC
ENSCAFT00000008769 MI0003668 hsa-miR-548d-5p AAAAGUAAUUGUGGUUUUUGCC
ENSCAFT00000008769 MI0003671 hsa-miR-548d-5p AAAAGUAAUUGUGGUUUUUGCC
ENSCAFT00000008769 MI0003679 hsa-miR-549 UGACAACUAUGGAUGAGCUCU
ENSCAFT00000008769 MI0003620 hsa-miR-607 GUUCAAAUCCAGAUCUAUAAC
ENSCAFT00000008769 MI0003906 hsa-miR-802 CAGUAACAAAGAUUCAUCCUUGU
ENSCAFT00000008769 MI0005769 hsa-miR-944 AAAUUAUUGUACAUCGGAUGAG
ENSCAFT00000008769 MI0004673 mmu-miR-669c AUAGUUGUGUGUGGAUGUGUGU
ENSCAFT00000008769 MI0004295 mmu-miR-670 AUCCCUGAGUGUAUGUGGUGAA
ENSCAFT00000008769 MI0004660 mmu-miR-692 AUCUCUUUGAGCGCCUCACUC
ENSCAFT00000008769 MI0004661 mmu-miR-692 AUCUCUUUGAGCGCCUCACUC
ENSCAFT00000008769 MI0004708 mmu-miR-721 CAGUGCAAUUAAAAGGGGGAA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene