ABCC8 | GeneID:485402 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 485402 Official Symbol ABCC8
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family C (CFTR/MRP), member 8
Chromosome N/A
Also Known As sulfonylurea receptor 1
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 68048

ID Symbol Protein Species
GeneID:6833 ABCC8 NP_000343.2 Homo sapiens
GeneID:20927 Abcc8 NP_035640.2 Mus musculus
GeneID:25559 Abcc8 NP_037171.1 Rattus norvegicus
GeneID:423072 ABCC8 XP_421005.2 Gallus gallus
GeneID:451056 ABCC8 XP_508310.2 Pan troglodytes
GeneID:485402 ABCC8 XP_542520.2 Canis lupus familiaris
GeneID:538996 ABCC8 XP_584132.3 Bos taurus
GeneID:553281 abcc8 XP_001920483.1 Danio rerio

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_542520 XP_542520

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000014193 MI0004753 bta-miR-125b UCCCUGAGACCCUAACUUGUGA
ENSCAFT00000014193 MI0005457 bta-miR-125b UCCCUGAGACCCUAACUUGUGA
ENSCAFT00000014193 MI0004740 bta-miR-18a UAAGGUGCAUCUAGUGCAGAUA
ENSCAFT00000014193 MI0004732 bta-miR-18b UAAGGUGCAUCUAGUGCAGUUA
ENSCAFT00000014193 MI0004758 bta-miR-199a-5p CCCAGUGUUCAGACUACCUGUU
ENSCAFT00000014193 MI0005036 bta-miR-199b CCCAGUGUUUAGACUAUCUGUUC
ENSCAFT00000014193 MI0000450 hsa-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENSCAFT00000014193 MI0000451 hsa-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENSCAFT00000014193 MI0000822 hsa-miR-133b UUUGGUCCCCUUCAACCAGCUA
ENSCAFT00000014193 MI0005569 hsa-miR-216b AAAUCUCUGCAGGCAAAUGUGA
ENSCAFT00000014193 MI0000744 hsa-miR-299-5p UGGUUUACCGUCCCACAUACAU
ENSCAFT00000014193 MI0000807 hsa-miR-323-5p AGGUGGUCCGUGGCGCGUUCGC
ENSCAFT00000014193 MI0000815 hsa-miR-339-5p UCCCUGUCCUCCAGGAGCUCACG
ENSCAFT00000014193 MI0003184 hsa-miR-500 UAAUCCUUGCUACCUGGGUGAGA
ENSCAFT00000014193 MI0003686 hsa-miR-542-3p UGUGACAGAUUGAUAACUGAAA
ENSCAFT00000014193 MI0003589 hsa-miR-582-5p UUACAGUUGUUCAACCAGUUACU
ENSCAFT00000014193 MI0003611 hsa-miR-599 GUUGUGUCAGUUUAUCAAAC
ENSCAFT00000014193 MI0003650 hsa-miR-635 ACUUGGGCACUGAAACAAUGUCC
ENSCAFT00000014193 MI0003674 hsa-miR-653 GUGUUGAAACAAUCUCUACUG
ENSCAFT00000014193 MI0003761 hsa-miR-668 UGUCACUCGGCUCGGCCCACUAC
ENSCAFT00000014193 MI0003763 hsa-miR-767-3p UCUGCUCAUACCCCAUGGUUUCU
ENSCAFT00000014193 MI0004295 mmu-miR-670 AUCCCUGAGUGUAUGUGGUGAA
ENSCAFT00000014193 MI0004662 mmu-miR-693-3p GCAGCUUUCAGAUGUGGCUGUAA
ENSCAFT00000014193 MI0004310 mmu-miR-764-3p AGGAGGCCAUAGUGGCAACUGU
ENSCAFT00000014193 MI0004310 mmu-miR-764-5p GGUGCUCACAUGUCCUCCU
ENSCAFT00000014193 MI0005548 mmu-miR-878-3p GCAUGACACCACACUGGGUAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene