ABHD14B | GeneID:484744 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 484744 Official Symbol ABHD14B
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description abhydrolase domain containing 14B
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 9125

ID Symbol Protein Species
GeneID:76491 Abhd14b NP_083907.2 Mus musculus
GeneID:84836 ABHD14B NP_116139.1 Homo sapiens
GeneID:300983 Abhd14b NP_001007665.1 Rattus norvegicus
GeneID:393338 zgc:64031 NP_956661.1 Danio rerio
GeneID:460411 ABHD14B XP_516497.2 Pan troglodytes
GeneID:484744 ABHD14B XP_541860.2 Canis lupus familiaris
GeneID:615289 ABHD14B XP_872147.2 Bos taurus
GeneID:100002339 LOC100002339 XP_001342146.2 Danio rerio

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_541860 XP_541860

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000015816 MI0005040 bta-miR-214 ACAGCAGGCACAGACAGGCAGU
ENSCAFT00000015816 MI0005775 hsa-miR-297 AUGUAUGUGUGCAUGUGCAUG
ENSCAFT00000015816 MI0001725 hsa-miR-329 AACACACCUGGUUAACCUCUUU
ENSCAFT00000015816 MI0001726 hsa-miR-329 AACACACCUGGUUAACCUCUUU
ENSCAFT00000015816 MI0000762 hsa-miR-362-3p AACACACCUAUUCAAGGAUUCA
ENSCAFT00000015816 MI0000787 hsa-miR-379 UGGUAGACUAUGGAACGUAGG
ENSCAFT00000015816 MI0003635 hsa-miR-621 GGCUAGCAACAGCGCUUACCU
ENSCAFT00000015816 MI0003661 hsa-miR-646 AAGCAGCUGCCUCUGAGGC
ENSCAFT00000015816 MI0003667 hsa-miR-652 AAUGGCGCCACUAGGGUUGUG
ENSCAFT00000015816 MI0005116 hsa-miR-765 UGGAGGAGAAGGAAGGUGAUG
ENSCAFT00000015816 MI0005714 hsa-miR-922 GCAGCAGAGAAUAGGACUACGUC
ENSCAFT00000015816 MI0005757 hsa-miR-935 CCAGUUACCGCUUCCGCUACCGC
ENSCAFT00000015816 MI0005762 hsa-miR-940 AAGGCAGGGCCCCCGCUCCCC
ENSCAFT00000015816 MI0002398 mmu-miR-463 UGAUAGACACCAUAUAAGGUAG
ENSCAFT00000015816 MI0005502 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENSCAFT00000015816 MI0005503 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENSCAFT00000015816 MI0005504 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENSCAFT00000015816 MI0005546 mmu-miR-466d-5p UGUGUGUGCGUACAUGUACAUG
ENSCAFT00000015816 MI0004523 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENSCAFT00000015816 MI0004667 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENSCAFT00000015816 MI0004668 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENSCAFT00000015816 MI0004653 mmu-miR-688 UCGCAGGCGACUACUUAUUC
ENSCAFT00000015816 MI0004306 mmu-miR-761 GCAGCAGGGUGAAACUGACACA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_541860  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene