ABHD14A | GeneID:484743 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 484743 Official Symbol ABHD14A
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description abhydrolase domain containing 14A
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 22889

ID Symbol Protein Species
GeneID:25864 ABHD14A NP_056222.1 Homo sapiens
GeneID:68644 Abhd14a NP_666031.1 Mus musculus
GeneID:176923 Y55F3AM.10 NP_500027.1 Caenorhabditis elegans
GeneID:300982 Abhd14a NP_001009670.1 Rattus norvegicus
GeneID:404598 zgc:85972 NP_996949.1 Danio rerio
GeneID:484743 ABHD14A XP_541859.2 Canis lupus familiaris
GeneID:515122 ABHD14A XP_593087.2 Bos taurus

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_541859 XP_541859

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000015810 MI0005019 bta-miR-345 GCUGACUCCUAGUCCAGUGCU
ENSCAFT00000015810 MI0003129 hsa-miR-146b-3p UGCCCUGUGGACUCAGUUCUGG
ENSCAFT00000015810 MI0000262 hsa-miR-147 GUGUGUGGAAAUGCUUCUGC
ENSCAFT00000015810 MI0002467 hsa-miR-483-3p UCACUCCUCUCCUCCCGUCUU
ENSCAFT00000015810 MI0003144 hsa-miR-515-5p UUCUCCAAAAGAAAGCACUUUCUG
ENSCAFT00000015810 MI0003147 hsa-miR-515-5p UUCUCCAAAAGAAAGCACUUUCUG
ENSCAFT00000015810 MI0003155 hsa-miR-520b AAAGUGCUUCCUUUUAGAGGG
ENSCAFT00000015810 MI0003158 hsa-miR-520c-3p AAAGUGCUUCCUUUUAGAGGGU
ENSCAFT00000015810 MI0003146 hsa-miR-520f AAGUGCUUCCUUUUAGAGGGUU
ENSCAFT00000015810 MI0003562 hsa-miR-556-3p AUAUUACCAUUAGCUCAUCUUU
ENSCAFT00000015810 MI0003582 hsa-miR-575 GAGCCAGUUGGACAGGAGC
ENSCAFT00000015810 MI0003611 hsa-miR-599 GUUGUGUCAGUUUAUCAAAC
ENSCAFT00000015810 MI0003617 hsa-miR-604 AGGCUGCGGAAUUCAGGAC
ENSCAFT00000015810 MI0003836 hsa-miR-766 ACUCCAGCCCCACAGCCUCAGC
ENSCAFT00000015810 MI0004646 mmu-miR-683 CCUGCUGUAAGCUGUGUCCUC
ENSCAFT00000015810 MI0004516 mmu-miR-763 CCAGCUGGGAAGAACCAGUGGC
ENSCAFT00000015810 MI0005548 mmu-miR-878-3p GCAUGACACCACACUGGGUAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_541859  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene