AANAT | GeneID:483331 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 483331 Official Symbol AANAT
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description arylalkylamine N-acetyltransferase
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 31013

ID Symbol Protein Species
GeneID:15 AANAT NP_001079.1 Homo sapiens
GeneID:11298 Aanat NP_033721.1 Mus musculus
GeneID:25120 Aanat NP_036950.1 Rattus norvegicus
GeneID:281583 AANAT NP_803475.1 Bos taurus
GeneID:393677 aanat1 NP_956998.1 Danio rerio
GeneID:396066 AANAT NP_990489.1 Gallus gallus
GeneID:483331 AANAT XP_540450.1 Canis lupus familiaris
GeneID:503504 AANAT NP_001012442.1 Pan troglodytes
GeneID:618594 AANAT XP_876019.2 Bos taurus

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001077437 NP_001070905
2 XM_540450 XP_540450

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000008185 MI0005007 bta-miR-10a UACCCUGUAGAUCCGAAUUUGUG
ENSCAFT00000008185 MI0005052 bta-miR-10b UACCCUGUAGAACCGAAUUUGUG
ENSCAFT00000008185 MI0004759 bta-miR-205 UCCUUCAUUCCACCGGAGUCUG
ENSCAFT00000008185 MI0004744 bta-miR-222 AGCUACAUCUGGCUACUGGGU
ENSCAFT00000008185 MI0005046 bta-miR-423 AAGCUCGGUCUGAGGCCCCUCAGU
ENSCAFT00000008185 MI0005468 bta-miR-660 UACCCAUUGCAUAUCGGAGCUG
ENSCAFT00000008185 MI0005050 bta-miR-93 CAAAGUGCUGUUCGUGCAGGUA
ENSCAFT00000008185 MI0000450 hsa-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENSCAFT00000008185 MI0000451 hsa-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENSCAFT00000008185 MI0000822 hsa-miR-133b UUUGGUCCCCUUCAACCAGCUA
ENSCAFT00000008185 MI0000478 hsa-miR-149 UCUGGCUCCGUGUCUUCACUCCC
ENSCAFT00000008185 MI0005529 hsa-miR-220b CCACCACCGUGUCUGACACUU
ENSCAFT00000008185 MI0000747 hsa-miR-296-5p AGGGCCCCCCCUCAAUCCUGU
ENSCAFT00000008185 MI0000826 hsa-miR-346 UGUCUGCCCGCAUGCCUGCCUCU
ENSCAFT00000008185 MI0000762 hsa-miR-362-5p AAUCCUUGGAACCUAGGUGUGAGU
ENSCAFT00000008185 MI0001735 hsa-miR-409-5p AGGUUACCCGAGCAACUUUGCAU
ENSCAFT00000008185 MI0002470 hsa-miR-486-5p UCCUGUACUGAGCUGCCCCGAG
ENSCAFT00000008185 MI0003126 hsa-miR-491-3p CUUAUGCAAGAUUCCCUUCUAC
ENSCAFT00000008185 MI0003184 hsa-miR-500 UAAUCCUUGCUACCUGGGUGAGA
ENSCAFT00000008185 MI0003198 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENSCAFT00000008185 MI0003199 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENSCAFT00000008185 MI0003200 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENSCAFT00000008185 MI0003178 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENSCAFT00000008185 MI0003182 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENSCAFT00000008185 MI0003151 hsa-miR-519b-3p AAAGUGCAUCCUUUUAGAGGUU
ENSCAFT00000008185 MI0003148 hsa-miR-519c-3p AAAGUGCAUCUUUUUAGAGGAU
ENSCAFT00000008185 MI0003162 hsa-miR-519d CAAAGUGCCUCCCUUUAGAGUG
ENSCAFT00000008185 MI0003150 hsa-miR-526b CUCUUGAGGGAAGCACUUUCUGU
ENSCAFT00000008185 MI0003615 hsa-miR-602 GACACGGGCGACAGCUGCGGCCC
ENSCAFT00000008185 MI0003618 hsa-miR-605 UAAAUCCCAUGGUGCCUUCUCCU
ENSCAFT00000008185 MI0003624 hsa-miR-611 GCGAGGACCCCUCGGGGUCUGAC
ENSCAFT00000008185 MI0003633 hsa-miR-619 GACCUGGACAUGUUUGUGCCCAGU
ENSCAFT00000008185 MI0003640 hsa-miR-626 AGCUGUCUGAAAAUGUCUU
ENSCAFT00000008185 MI0003647 hsa-miR-632 GUGUCUGCUUCCUGUGGGA
ENSCAFT00000008185 MI0003683 hsa-miR-659 CUUGGUUCAGGGAGGGUCCCCA
ENSCAFT00000008185 MI0003763 hsa-miR-767-5p UGCACCAUGGUUGUCUGAGCAUG
ENSCAFT00000008185 MI0005560 hsa-miR-885-5p UCCAUUACACUACCCUGCCUCU
ENSCAFT00000008185 MI0005533 hsa-miR-890 UACUUGGAAAGGCAUCAGUUG
ENSCAFT00000008185 MI0003539 mmu-miR-291b-3p AAAGUGCAUCCAUUUUGUUUGU
ENSCAFT00000008185 MI0005513 mmu-miR-467d UAAGUGCGCGCAUGUAUAUGCG
ENSCAFT00000008185 MI0004196 mmu-miR-667 UGACACCUGCCACCCAGCCCAAG
ENSCAFT00000008185 MI0004295 mmu-miR-670 AUCCCUGAGUGUAUGUGGUGAA
ENSCAFT00000008185 MI0004601 mmu-miR-673-5p CUCACAGCUCUGGUCCUUGGAG
ENSCAFT00000008185 MI0004646 mmu-miR-683 CCUGCUGUAAGCUGUGUCCUC
ENSCAFT00000008185 MI0004662 mmu-miR-693-5p CAGCCACAUCCGAAAGUUUUC
ENSCAFT00000008185 MI0004695 mmu-miR-711 GGGACCCGGGGAGAGAUGUAAG
ENSCAFT00000008185 MI0004699 mmu-miR-714 CGACGAGGGCCGGUCGGUCGC
ENSCAFT00000008185 MI0005475 mmu-miR-882 AGGAGAGAGUUAGCGCAUUAGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Klein DC, et al. (2007) "Arylalkylamine N-acetyltransferase: "the Timezyme"." J Biol Chem. 282(7):4233-4237. PMID:17164235