ABCF2 | GeneID:482806 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 482806 Official Symbol ABCF2
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family F (GCN20), member 2
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 21408

ID Symbol Protein Species
GeneID:10061 ABCF2 NP_005683.2 Homo sapiens
GeneID:27407 Abcf2 NP_038881.1 Mus musculus
GeneID:32508 CG9281 NP_573057.1 Drosophila melanogaster
GeneID:176771 abcf-2 NP_499779.1 Caenorhabditis elegans
GeneID:311959 Abcf2 XP_231307.1 Rattus norvegicus
GeneID:336770 abcf2 NP_958472.1 Danio rerio
GeneID:426038 ABCF2 NP_001006562.1 Gallus gallus
GeneID:463887 ABCF2 XP_001139777.1 Pan troglodytes
GeneID:482806 ABCF2 XP_850220.1 Canis lupus familiaris
GeneID:513061 ABCF2 NP_001039601.1 Bos taurus
GeneID:836200 ATGCN1 NP_200887.1 Arabidopsis thaliana
GeneID:1273267 AgaP_AGAP002693 XP_312228.2 Anopheles gambiae
GeneID:4346343 Os08g0564100 NP_001062528.1 Oryza sativa
GeneID:4347924 Os09g0572400 NP_001063997.1 Oryza sativa
GeneID:100000576 LOC100000576 XP_001337123.1 Danio rerio

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000007804 MI0005007 bta-miR-10a UACCCUGUAGAUCCGAAUUUGUG
ENSCAFT00000007804 MI0005052 bta-miR-10b UACCCUGUAGAACCGAAUUUGUG
ENSCAFT00000007804 MI0005029 bta-miR-138 AGCUGGUGUUGUGAAUCAGGCCG
ENSCAFT00000007804 MI0005010 bta-miR-140 UACCACAGGGUAGAACCACGGA
ENSCAFT00000007804 MI0005012 bta-miR-15b UAGCAGCACAUCAUGGUUUACA
ENSCAFT00000007804 MI0005459 bta-miR-195 UAGCAGCACAGAAAUAUUGGCA
ENSCAFT00000007804 MI0005066 bta-miR-23b AUCACAUUGCCAGGGAUUACCAC
ENSCAFT00000007804 MI0005020 bta-miR-369-3p AAUAAUACAUGGUUGAUCUUU
ENSCAFT00000007804 MI0005467 bta-miR-497 CAGCAGCACACUGUGGUUUGUA
ENSCAFT00000007804 MI0004751 bta-miR-99a AACCCGUAGAUCCGAUCUUGU
ENSCAFT00000007804 MI0000102 hsa-miR-100 AACCCGUAGAUCCGAACUUGUG
ENSCAFT00000007804 MI0000273 hsa-miR-183 UAUGGCACUGGUAGAAUUCACU
ENSCAFT00000007804 MI0000090 hsa-miR-32 UAUUGCACAUUACUAAGUUGCA
ENSCAFT00000007804 MI0000807 hsa-miR-323-3p CACAUUACACGGUCGACCUCU
ENSCAFT00000007804 MI0000802 hsa-miR-340 UUAUAAAGCAAUGAGACUGAUU
ENSCAFT00000007804 MI0000779 hsa-miR-371-3p AAGUGCCGCCAUCUUUUGAGUGU
ENSCAFT00000007804 MI0000783 hsa-miR-375 UUUGUUCGUUCGGCUCGCGUGA
ENSCAFT00000007804 MI0001735 hsa-miR-409-5p AGGUUACCCGAGCAACUUUGCAU
ENSCAFT00000007804 MI0001446 hsa-miR-424 CAGCAGCAAUUCAUGUUUUGAA
ENSCAFT00000007804 MI0003133 hsa-miR-432 UCUUGGAGUAGGUCAUUGGGUGG
ENSCAFT00000007804 MI0001723 hsa-miR-433 AUCAUGAUGGGCUCCUCGGUGU
ENSCAFT00000007804 MI0003188 hsa-miR-503 UAGCAGCGGGAACAGUUCUGCAG
ENSCAFT00000007804 MI0003194 hsa-miR-507 UUUUGCACCUUUUGGAGUGAA
ENSCAFT00000007804 MI0003156 hsa-miR-518b CAAAGCGCUCCCCUUUAGAGGU
ENSCAFT00000007804 MI0003163 hsa-miR-521 AACGCACUUCCCUUUAGAGUGU
ENSCAFT00000007804 MI0003176 hsa-miR-521 AACGCACUUCCCUUUAGAGUGU
ENSCAFT00000007804 MI0003686 hsa-miR-542-5p UCGGGGAUCAUCAUGUCACGAGA
ENSCAFT00000007804 MI0003569 hsa-miR-563 AGGUUGACAUACGUUUCCC
ENSCAFT00000007804 MI0003640 hsa-miR-626 AGCUGUCUGAAAAUGUCUU
ENSCAFT00000007804 MI0003651 hsa-miR-636 UGUGCUUGCUCGUCCCGCCCGCA
ENSCAFT00000007804 MI0003760 hsa-miR-671-3p UCCGGUUCUCAGGGCUCCACC
ENSCAFT00000007804 MI0005567 hsa-miR-760 CGGCUCUGGGUCUGUGGGGA
ENSCAFT00000007804 MI0005541 hsa-miR-875-5p UAUACCUCAGUUUUAUCAGGUG
ENSCAFT00000007804 MI0005560 hsa-miR-885-5p UCCAUUACACUACCCUGCCUCU
ENSCAFT00000007804 MI0000390 mmu-miR-292-3p AAAGUGCCGCCAGGUUUUGAGUGU
ENSCAFT00000007804 MI0000590 mmu-miR-322 CAGCAGCAAUUCAUGUUUUGGA
ENSCAFT00000007804 MI0001526 mmu-miR-434-3p UUUGAACCAUCACUCGACUCCU
ENSCAFT00000007804 MI0004643 mmu-miR-681 CAGCCUCGCUGGCAGGCAGCU
ENSCAFT00000007804 MI0004694 mmu-miR-710 CCAAGUCUUGGGGAGAGUUGAG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene