AASS | GeneID:482429 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 482429 Official Symbol AASS
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description aminoadipate-semialdehyde synthase
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 4212

ID Symbol Protein Species
GeneID:10157 AASS NP_005754.2 Homo sapiens
GeneID:30956 Aass NP_038958.2 Mus musculus
GeneID:34064 CG7144 NP_609150.2 Drosophila melanogaster
GeneID:176842 dehydrogenase NP_499884.1 Caenorhabditis elegans
GeneID:296925 Aass XP_231524.4 Rattus norvegicus
GeneID:417757 AASS XP_416001.2 Gallus gallus
GeneID:472493 AASS XP_527868.2 Pan troglodytes
GeneID:482429 AASS XP_539546.2 Canis lupus familiaris
GeneID:520865 AASS XP_599115.3 Bos taurus
GeneID:556229 aass XP_684074.3 Danio rerio
GeneID:855786 LYS9 NP_014448.1 Saccharomyces cerevisiae
GeneID:1275481 AgaP_AGAP008632 XP_314728.2 Anopheles gambiae
GeneID:2540908 SPBC3B8.03 NP_596411.1 Schizosaccharomyces pombe
GeneID:2678741 MGG_08564 XP_362873.1 Magnaporthe grisea
GeneID:2704923 NCU03748.1 XP_323050.1 Neurospora crassa
GeneID:2892518 KLLA0C18744g XP_453035.1 Kluyveromyces lactis

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_539546 XP_539546

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000005673 MI0005011 bta-miR-142 CAUAAAGUAGAAAGCACUAC
ENSCAFT00000005673 MI0004757 bta-miR-181a AACAUUCAACGCUGUCGGUGAGUU
ENSCAFT00000005673 MI0005013 bta-miR-181b AACAUUCAUUGCUGUCGGUGGGUUU
ENSCAFT00000005673 MI0005032 bta-miR-181c AACAUUCAACCUGUCGGUGAGUUU
ENSCAFT00000005673 MI0005064 bta-miR-30c UGUAAACAUCCUACACUCUCAGC
ENSCAFT00000005673 MI0005047 bta-miR-425-3p AUCGGGAAUGUCGUGUCCGCCC
ENSCAFT00000005673 MI0004750 bta-miR-499 UUAAGACUUGCAGUGAUGUUU
ENSCAFT00000005673 MI0000238 hsa-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENSCAFT00000005673 MI0000279 hsa-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENSCAFT00000005673 MI0000300 hsa-miR-223 UGUCAGUUUGUCAAAUACCCCA
ENSCAFT00000005673 MI0000789 hsa-miR-381 UAUACAAGGGCAAGCUCUCUGU
ENSCAFT00000005673 MI0003686 hsa-miR-542-3p UGUGACAGAUUGAUAACUGAAA
ENSCAFT00000005673 MI0003562 hsa-miR-556-3p AUAUUACCAUUAGCUCAUCUUU
ENSCAFT00000005673 MI0003605 hsa-miR-593 UGUCUCUGCUGGGGUUUCU
ENSCAFT00000005673 MI0005537 hsa-miR-888 UACUCAAAAAGCUGUCAGUCA
ENSCAFT00000005673 MI0005507 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSCAFT00000005673 MI0005508 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSCAFT00000005673 MI0005509 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSCAFT00000005673 MI0004673 mmu-miR-669c AUAGUUGUGUGUGGAUGUGUGU
ENSCAFT00000005673 MI0005470 mmu-miR-743b-5p UGUUCAGACUGGUGUCCAUCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_539546  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene