ABCB5 | GeneID:482344 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 482344 Official Symbol ABCB5
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family B (MDR/TAP), member 5
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 83488

ID Symbol Protein Species
GeneID:77706 Abcb5 XP_001002680.2 Mus musculus
GeneID:314537 Abcb5 XP_234725.4 Rattus norvegicus
GeneID:340273 ABCB5 NP_848654.3 Homo sapiens
GeneID:482344 ABCB5 XP_539461.2 Canis lupus familiaris
GeneID:743269 ABCB5 XP_001152831.1 Pan troglodytes
GeneID:839687 PGP13 NP_174115.1 Arabidopsis thaliana
GeneID:839694 PGP14 NP_174122.1 Arabidopsis thaliana

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_539461 XP_539461

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000004202 MI0005015 bta-miR-20b CAAAGUGCUCACAGUGCAGGUA
ENSCAFT00000004202 MI0005021 bta-miR-380-5p UGGUUGACCAUAGAACAUGCGC
ENSCAFT00000004202 MI0000486 hsa-miR-190 UGAUAUGUUUGAUAUAUUAGGU
ENSCAFT00000004202 MI0005523 hsa-miR-298 AGCAGAAGCAGGGAGGUUCUCCCA
ENSCAFT00000004202 MI0000791 hsa-miR-383 AGAUCAGAAGGUGAUUGUGGCU
ENSCAFT00000004202 MI0003685 hsa-miR-421 AUCAACAGACAUUAAUUGGGCGC
ENSCAFT00000004202 MI0003167 hsa-miR-516b AUCUGGAGGUAAGAAGCACUUU
ENSCAFT00000004202 MI0003172 hsa-miR-516b AUCUGGAGGUAAGAAGCACUUU
ENSCAFT00000004202 MI0003149 hsa-miR-520a-5p CUCCAGAGGGAAGUACUUUCU
ENSCAFT00000004202 MI0003164 hsa-miR-520d-5p CUACAAAGGGAAGCCCUUUC
ENSCAFT00000004202 MI0003166 hsa-miR-520g ACAAAGUGCUUCCCUUUAGAGUGU
ENSCAFT00000004202 MI0003175 hsa-miR-520h ACAAAGUGCUUCCCUUUAGAGU
ENSCAFT00000004202 MI0003564 hsa-miR-558 UGAGCUGCUGUACCAAAAU
ENSCAFT00000004202 MI0003602 hsa-miR-590-3p UAAUUUUAUGUAUAAGCUAGU
ENSCAFT00000004202 MI0000097 hsa-miR-95 UUCAACGGGUAUUUAUUGAGCA
ENSCAFT00000004202 MI0003539 mmu-miR-291b-5p GAUCAAAGUGGAGGCCCUCUCC
ENSCAFT00000004202 MI0005510 mmu-miR-466g AUACAGACACAUGCACACACA
ENSCAFT00000004202 MI0005511 mmu-miR-466h UGUGUGCAUGUGCUUGUGUGUA
ENSCAFT00000004202 MI0003523 mmu-miR-547 CUUGGUACAUCUUUGAGUGAG
ENSCAFT00000004202 MI0004553 mmu-miR-666-3p GGCUGCAGCGUGAUCGCCUGCU
ENSCAFT00000004202 MI0004523 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENSCAFT00000004202 MI0004667 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENSCAFT00000004202 MI0004668 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENSCAFT00000004202 MI0005476 mmu-miR-883a-3p UAACUGCAACAGCUCUCAGUAU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_539461  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene