AASDH | GeneID:482159 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 482159 Official Symbol AASDH
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description aminoadipate-semialdehyde dehydrogenase
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 71711

ID Symbol Protein Species
GeneID:34175 U26 NP_609230.2 Drosophila melanogaster
GeneID:132949 AASDH NP_861522.2 Homo sapiens
GeneID:231326 Aasdh NP_776126.1 Mus musculus
GeneID:364136 Aasdh XP_344231.2 Rattus norvegicus
GeneID:422744 AASDH XP_420697.2 Gallus gallus
GeneID:471237 AASDH XP_526619.2 Pan troglodytes
GeneID:482159 AASDH XP_539278.2 Canis lupus familiaris
GeneID:570338 si:dkeyp-117h8.3 XP_698902.2 Danio rerio
GeneID:782093 AASDH XP_001250589.1 Bos taurus
GeneID:833582 AT5G35930 NP_198442.2 Arabidopsis thaliana
GeneID:1279502 AgaP_AGAP010071 XP_319228.2 Anopheles gambiae
GeneID:4339893 Os06g0111600 NP_001056587.1 Oryza sativa

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_539278 XP_539278
2 XM_855039 XP_860132
3 XM_855081 XP_860174

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000003472 MI0005046 bta-miR-423 AAGCUCGGUCUGAGGCCCCUCAGU
ENSCAFT00000003472 MI0000292 hsa-miR-216a UAAUCUCAGCUGGCAACUGUGA
ENSCAFT00000003472 MI0003124 hsa-miR-489 GUGACAUCACAUAUACGGCAGC
ENSCAFT00000003472 MI0003127 hsa-miR-511 GUGUCUUUUGCUCUGCAGUCA
ENSCAFT00000003472 MI0003128 hsa-miR-511 GUGUCUUUUGCUCUGCAGUCA
ENSCAFT00000003472 MI0003607 hsa-miR-595 GAAGUGUGCCGUGGUGUGUCU
ENSCAFT00000003472 MI0003628 hsa-miR-615-3p UCCGAGCCUGGGUCUCCCUCUU
ENSCAFT00000003472 MI0003641 hsa-miR-627 GUGAGUCUCUAAGAAAAGAGGA
ENSCAFT00000003472 MI0003657 hsa-miR-642 GUCCCUCUCCAAAUGUGUCUUG
ENSCAFT00000003472 MI0003539 mmu-miR-291b-3p AAAGUGCAUCCAUUUUGUUUGU
ENSCAFT00000003472 MI0004690 mmu-miR-706 AGAGAAACCCUGUCUCAAAAAA
ENSCAFT00000003472 MI0004678 mmu-miR-720 AUCUCGCUGGGGCCUCCA
ENSCAFT00000003472 MI0004708 mmu-miR-721 CAGUGCAAUUAAAAGGGGGAA
ENSCAFT00000003472 MI0005548 mmu-miR-878-3p GCAUGACACCACACUGGGUAGA
ENSCAFT00000003472 MI0005548 mmu-miR-878-5p UAUCUAGUUGGAUGUCAAGACA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene