ABCA1 | GeneID:481651 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 481651 Official Symbol ABCA1
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family A (ABC1), member 1
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 21130

ID Symbol Protein Species
GeneID:19 ABCA1 NP_005493.2 Homo sapiens
GeneID:11303 Abca1 NP_038482.3 Mus musculus
GeneID:313210 Abca1 NP_835196.1 Rattus norvegicus
GeneID:373945 ABCA1 NP_989476.1 Gallus gallus
GeneID:464630 ABCA1 XP_001138040.1 Pan troglodytes
GeneID:481651 ABCA1 XP_538773.2 Canis lupus familiaris
GeneID:535379 ABCA1 NP_001019864.1 Bos taurus
GeneID:558924 abca1a XP_687304.3 Danio rerio
GeneID:818768 AT2G41700 NP_850354.2 Arabidopsis thaliana

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab14146 ABCA1 antibody (ab14146); Rabbit polyclonal to ABCA1

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_538773 XP_538773

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000004346 MI0004734 bta-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENSCAFT00000004346 MI0005062 bta-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENSCAFT00000004346 MI0005007 bta-miR-10a UACCCUGUAGAUCCGAAUUUGUG
ENSCAFT00000004346 MI0004756 bta-miR-145 GUCCAGUUUUCCCAGGAAUCCCU
ENSCAFT00000004346 MI0004757 bta-miR-181a AACAUUCAACGCUGUCGGUGAGUU
ENSCAFT00000004346 MI0005013 bta-miR-181b AACAUUCAUUGCUGUCGGUGGGUUU
ENSCAFT00000004346 MI0005047 bta-miR-425-3p AUCGGGAAUGUCGUGUCCGCCC
ENSCAFT00000004346 MI0005061 bta-miR-532 CAUGCCUUGAGUGUAGGACCGU
ENSCAFT00000004346 MI0005025 bta-miR-98 UGAGGUAGUAAGUUGUAUUGUU
ENSCAFT00000004346 MI0004751 bta-miR-99a AACCCGUAGAUCCGAUCUUGU
ENSCAFT00000004346 MI0005469 bta-miR-99b CACCCGUAGAACCGACCUUGCG
ENSCAFT00000004346 MI0000102 hsa-miR-100 AACCCGUAGAUCCGAACUUGUG
ENSCAFT00000004346 MI0000460 hsa-miR-144 UACAGUAUAGAUGAUGUACU
ENSCAFT00000004346 MI0000272 hsa-miR-182 UUUGGCAAUGGUAGAACUCACACU
ENSCAFT00000004346 MI0000273 hsa-miR-183 UAUGGCACUGGUAGAAUUCACU
ENSCAFT00000004346 MI0000288 hsa-miR-212 UAACAGUCUCCAGUCACGGCC
ENSCAFT00000004346 MI0000744 hsa-miR-299-5p UGGUUUACCGUCCCACAUACAU
ENSCAFT00000004346 MI0005525 hsa-miR-300 UAUACAAGGGCAGACUCUCUCU
ENSCAFT00000004346 MI0000806 hsa-miR-337-5p GAACGGCUUCAUACAGGAGUU
ENSCAFT00000004346 MI0000091 hsa-miR-33a GUGCAUUGUAGUUGCAUUGCA
ENSCAFT00000004346 MI0003646 hsa-miR-33b GUGCAUUGCUGUUGCAUUGC
ENSCAFT00000004346 MI0000789 hsa-miR-381 UAUACAAGGGCAAGCUCUCUGU
ENSCAFT00000004346 MI0003193 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
ENSCAFT00000004346 MI0003165 hsa-miR-517b UCGUGCAUCCCUUUAGAGUGUU
ENSCAFT00000004346 MI0003170 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENSCAFT00000004346 MI0003173 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENSCAFT00000004346 MI0003164 hsa-miR-520d-5p CUACAAAGGGAAGCCCUUUC
ENSCAFT00000004346 MI0003153 hsa-miR-523 GAACGCGCUUCCCUAUAGAGGGU
ENSCAFT00000004346 MI0003160 hsa-miR-524-3p GAAGGCGCUUCCCUUUGGAGU
ENSCAFT00000004346 MI0003160 hsa-miR-524-5p CUACAAAGGGAAGCACUUUCUC
ENSCAFT00000004346 MI0003152 hsa-miR-525-3p GAAGGCGCUUCCCUUUAGAGCG
ENSCAFT00000004346 MI0003570 hsa-miR-564 AGGCACGGUGUCAGCAGGC
ENSCAFT00000004346 MI0003574 hsa-miR-568 AUGUAUAAAUGUAUACACAC
ENSCAFT00000004346 MI0003581 hsa-miR-574-3p CACGCUCAUGCACACACCCACA
ENSCAFT00000004346 MI0003609 hsa-miR-597 UGUGUCACUCGAUGACCACUGU
ENSCAFT00000004346 MI0003620 hsa-miR-607 GUUCAAAUCCAGAUCUAUAAC
ENSCAFT00000004346 MI0003642 hsa-miR-628-3p UCUAGUAAGAGUGGCAGUCGA
ENSCAFT00000004346 MI0003656 hsa-miR-641 AAAGACAUAGGAUAGAGUCACCUC
ENSCAFT00000004346 MI0003667 hsa-miR-652 AAUGGCGCCACUAGGGUUGUG
ENSCAFT00000004346 MI0005534 hsa-miR-891b UGCAACUUACCUGAGUCAUUGA
ENSCAFT00000004346 MI0000098 hsa-miR-96 UUUGGCACUAGCACAUUUUUGCU
ENSCAFT00000004346 MI0005493 mmu-miR-327 ACUUGAGGGGCAUGAGGAU
ENSCAFT00000004346 MI0004666 mmu-miR-669b AGUUUUGUGUGCAUGUGCAUGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_538773  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene