ABCG5 | GeneID:481354 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 481354 Official Symbol ABCG5
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family G (WHITE), member 5
Chromosome N/A
Also Known As ATP-binding cassette, sub-family G (WHITE), member 5 (sterolin 1)
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 31909

ID Symbol Protein Species
GeneID:27409 Abcg5 NP_114090.1 Mus musculus
GeneID:42976 CG11069 NP_651307.2 Drosophila melanogaster
GeneID:64240 ABCG5 NP_071881.1 Homo sapiens
GeneID:114628 Abcg5 NP_446206.2 Rattus norvegicus
GeneID:421401 ABCG5 XP_419457.2 Gallus gallus
GeneID:481354 ABCG5 XP_538475.1 Canis lupus familiaris
GeneID:515536 ABCG5 NP_001019718.1 Bos taurus
GeneID:557317 LOC557317 XP_684646.1 Danio rerio
GeneID:1281061 AgaP_AGAP002051 XP_320996.2 Anopheles gambiae

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_538475 XP_538475

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000003956 MI0005007 bta-miR-10a UACCCUGUAGAUCCGAAUUUGUG
ENSCAFT00000003956 MI0005028 bta-miR-132 UAACAGUCUACAGCCAUGGUCG
ENSCAFT00000003956 MI0004757 bta-miR-181a AACAUUCAACGCUGUCGGUGAGUU
ENSCAFT00000003956 MI0005013 bta-miR-181b AACAUUCAUUGCUGUCGGUGGGUUU
ENSCAFT00000003956 MI0005032 bta-miR-181c AACAUUCAACCUGUCGGUGAGUUU
ENSCAFT00000003956 MI0005035 bta-miR-192 CUGACCUAUGAAUUGACAGCCAG
ENSCAFT00000003956 MI0005014 bta-miR-193a AACUGGCCUACAAAGUCCCAGU
ENSCAFT00000003956 MI0004758 bta-miR-199a-3p ACAGUAGUCUGCACAUUGGUUA
ENSCAFT00000003956 MI0005016 bta-miR-215 AUGACCUAUGAAUUGACAGACA
ENSCAFT00000003956 MI0004746 bta-miR-27a UUCACAGUGGCUAAGUUCCG
ENSCAFT00000003956 MI0004760 bta-miR-27b UUCACAGUGGCUAAGUUCUGC
ENSCAFT00000003956 MI0004761 bta-miR-30b UGUAAACAUCCUACACUCAGCU
ENSCAFT00000003956 MI0005064 bta-miR-30c UGUAAACAUCCUACACUCUCAGC
ENSCAFT00000003956 MI0004747 bta-miR-30d UGUAAACAUCCCCGACUGGAAGCU
ENSCAFT00000003956 MI0000452 hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENSCAFT00000003956 MI0000453 hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENSCAFT00000003956 MI0000810 hsa-miR-135b UAUGGCUUUUCAUUCCUAUGUGA
ENSCAFT00000003956 MI0000288 hsa-miR-212 UAACAGUCUCCAGUCACGGCC
ENSCAFT00000003956 MI0000292 hsa-miR-216a UAAUCUCAGCUGGCAACUGUGA
ENSCAFT00000003956 MI0000293 hsa-miR-217 UACUGCAUCAGGAACUGAUUGGA
ENSCAFT00000003956 MI0000813 hsa-miR-324-3p ACUGCCCCAGGUGCUGCUGG
ENSCAFT00000003956 MI0003125 hsa-miR-490-5p CCAUGGAUCUCCAGGUGGGU
ENSCAFT00000003956 MI0003190 hsa-miR-505 CGUCAACACUUGCUGGUUUCCU
ENSCAFT00000003956 MI0003577 hsa-miR-570 CGAAAACAGCAAUUACCUUUGC
ENSCAFT00000003956 MI0003589 hsa-miR-582-3p UAACUGGUUGAACAACUGAACC
ENSCAFT00000003956 MI0003590 hsa-miR-583 CAAAGAGGAAGGUCCCAUUAC
ENSCAFT00000003956 MI0003602 hsa-miR-590-3p UAAUUUUAUGUAUAAGCUAGU
ENSCAFT00000003956 MI0003659 hsa-miR-644 AGUGUGGCUUUCUUAGAGC
ENSCAFT00000003956 MI0002399 mmu-miR-464 UACCAAGUUUAUUCUGUGAGAUA
ENSCAFT00000003956 MI0006128 mmu-miR-467e AUAAGUGUGAGCAUGUAUAUGU
ENSCAFT00000003956 MI0002403 mmu-miR-468 UAUGACUGAUGUGCGUGUGUCUG
ENSCAFT00000003956 MI0004675 mmu-miR-695 AGAUUGGGCAUAGGUGACUGAA
ENSCAFT00000003956 MI0004691 mmu-miR-707 CAGUCAUGCCGCUUGCCUACG
ENSCAFT00000003956 MI0005203 mmu-miR-804 UGUGAGUUGUUCCUCACCUGGA
ENSCAFT00000003956 MI0005476 mmu-miR-883a-3p UAACUGCAACAGCUCUCAGUAU
ENSCAFT00000003956 MI0005477 mmu-miR-883b-3p UAACUGCAACAUCUCUCAGUAU
ENSCAFT00000003956 MI0000644 rno-miR-352 AGAGUAGUAGGUUGCAUAGUA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_538475  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]