A4GALT | GeneID:481222 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 481222 Official Symbol A4GALT
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description alpha 1,4-galactosyltransferase
Chromosome N/A
Also Known As alpha 1,4-galactosyltransferase (globotriaosylceramide synthase)
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 9690

ID Symbol Protein Species
GeneID:33512 alpha4GT1 NP_608737.1 Drosophila melanogaster
GeneID:43124 alpha4GT2 NP_651434.2 Drosophila melanogaster
GeneID:53947 A4GALT NP_059132.1 Homo sapiens
GeneID:63888 A4galt NP_071576.1 Rattus norvegicus
GeneID:239559 A4galt NP_001004150.1 Mus musculus
GeneID:418223 A4GALT XP_416448.2 Gallus gallus
GeneID:470230 A4GALT NP_001009123.1 Pan troglodytes
GeneID:481222 A4GALT XP_538343.2 Canis lupus familiaris
GeneID:1277725 AgaP_AGAP008258 XP_317211.2 Anopheles gambiae
GeneID:3291688 AgaP_AGAP008260 XP_555205.1 Anopheles gambiae

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_538343 XP_538343

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000001468 MI0005033 bta-miR-186 CAAAGAAUUCUCCUUUUGGGCU
ENSCAFT00000001468 MI0004742 bta-miR-21 UAGCUUAUCAGACUGAUGUUGACU
ENSCAFT00000001468 MI0005049 bta-miR-455 UAUGUGCCUUUGGACUACAUC
ENSCAFT00000001468 MI0000747 hsa-miR-296-3p GAGGGUUGGGUGGAGGCUCUCC
ENSCAFT00000001468 MI0000813 hsa-miR-324-3p ACUGCCCCAGGUGCUGCUGG
ENSCAFT00000001468 MI0000806 hsa-miR-337-3p CUCCUAUAUGAUGCCUUUCUUC
ENSCAFT00000001468 MI0002467 hsa-miR-483-3p UCACUCCUCUCCUCCCGUCUU
ENSCAFT00000001468 MI0003185 hsa-miR-501-3p AAUGCACCCGGGCAAGGAUUCU
ENSCAFT00000001468 MI0003186 hsa-miR-502-3p AAUGCACCUGGGCAAGGAUUCA
ENSCAFT00000001468 MI0003193 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
ENSCAFT00000001468 MI0003194 hsa-miR-507 UUUUGCACCUUUUGGAGUGAA
ENSCAFT00000001468 MI0003165 hsa-miR-517b UCGUGCAUCCCUUUAGAGUGUU
ENSCAFT00000001468 MI0003174 hsa-miR-517c AUCGUGCAUCCUUUUAGAGUGU
ENSCAFT00000001468 MI0003156 hsa-miR-518b CAAAGCGCUCCCCUUUAGAGGU
ENSCAFT00000001468 MI0003171 hsa-miR-518d-3p CAAAGCGCUUCCCUUUGGAGC
ENSCAFT00000001468 MI0003154 hsa-miR-518f GAAAGCGCUUCUCUUUAGAGG
ENSCAFT00000001468 MI0003152 hsa-miR-525-5p CUCCAGAGGGAUGCACUUUCU
ENSCAFT00000001468 MI0003572 hsa-miR-566 GGGCGCCUGUGAUCCCAAC
ENSCAFT00000001468 MI0003573 hsa-miR-567 AGUAUGUUCUUCCAGGACAGAAC
ENSCAFT00000001468 MI0003608 hsa-miR-596 AAGCCUGCCCGGCUCCUCGGG
ENSCAFT00000001468 MI0003633 hsa-miR-619 GACCUGGACAUGUUUGUGCCCAGU
ENSCAFT00000001468 MI0003655 hsa-miR-640 AUGAUCCAGGAACCUGCCUCU
ENSCAFT00000001468 MI0003660 hsa-miR-645 UCUAGGCUGGUACUGCUGA
ENSCAFT00000001468 MI0003662 hsa-miR-647 GUGGCUGCACUCACUUCCUUC
ENSCAFT00000001468 MI0003670 hsa-miR-662 UCCCACGUUGUGGCCCAGCAG
ENSCAFT00000001468 MI0005533 hsa-miR-890 UACUUGGAAAGGCAUCAGUUG
ENSCAFT00000001468 MI0005763 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENSCAFT00000001468 MI0005764 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENSCAFT00000001468 MI0005765 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENSCAFT00000001468 MI0005766 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENSCAFT00000001468 MI0000643 mmu-miR-351 UCCCUGAGGAGCCCUUUGAGCCUG
ENSCAFT00000001468 MI0002405 mmu-miR-470 UUCUUGGACUGGCACUGGUGAGU
ENSCAFT00000001468 MI0004553 mmu-miR-666-3p GGCUGCAGCGUGAUCGCCUGCU
ENSCAFT00000001468 MI0004643 mmu-miR-681 CAGCCUCGCUGGCAGGCAGCU
ENSCAFT00000001468 MI0004649 mmu-miR-685 UCAAUGGCUGAGGUGAGGCAC
ENSCAFT00000001468 MI0004681 mmu-miR-697 AACAUCCUGGUCCUGUGGAGA
ENSCAFT00000001468 MI0004686 mmu-miR-702 UGCCCACCCUUUACCCCGCUC
ENSCAFT00000001468 MI0004678 mmu-miR-720 AUCUCGCUGGGGCCUCCA
ENSCAFT00000001468 MI0004310 mmu-miR-764-5p GGUGCUCACAUGUCCUCCU
ENSCAFT00000001468 MI0005472 mmu-miR-879 AGAGGCUUAUAGCUCUAAGCC
ENSCAFT00000001468 MI0000613 rno-miR-336 UCACCCUUCCAUAUCUAGUCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_538343  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]