AATF | GeneID:480595 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 480595 Official Symbol AATF
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description apoptosis antagonizing transcription factor
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 40811

ID Symbol Protein Species
GeneID:26574 AATF NP_036270.1 Homo sapiens
GeneID:33943 CG11188 NP_609066.1 Drosophila melanogaster
GeneID:56321 Aatf NP_062790.1 Mus musculus
GeneID:114512 Aatf NP_446172.1 Rattus norvegicus
GeneID:171723 Y73E7A.2 NP_490870.2 Caenorhabditis elegans
GeneID:417653 AATF NP_001025895.1 Gallus gallus
GeneID:454601 AATF XP_511427.2 Pan troglodytes
GeneID:480595 AATF XP_537715.2 Canis lupus familiaris
GeneID:559477 aatf NP_001077297.1 Danio rerio
GeneID:786013 AATF XP_001252958.1 Bos taurus
GeneID:836254 AT5G61330 NP_200941.2 Arabidopsis thaliana
GeneID:851893 BFR2 NP_010585.1 Saccharomyces cerevisiae
GeneID:1269788 AgaP_AGAP007394 XP_308438.2 Anopheles gambiae
GeneID:2543540 SPAC664.08c NP_593456.1 Schizosaccharomyces pombe
GeneID:2677840 MGG_04641 XP_362196.2 Magnaporthe grisea
GeneID:2706053 NCU04787.1 XP_324144.1 Neurospora crassa
GeneID:2892016 KLLA0C10362g XP_452661.1 Kluyveromyces lactis
GeneID:4323936 Os01g0526200 NP_001043227.1 Oryza sativa
GeneID:4618523 AGOS_AAL064W NP_982478.1 Eremothecium gossypii

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_537715 XP_537715
2 XM_862407 XP_867500
3 XM_862416 XP_867509

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000028358 MI0004736 bta-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENSCAFT00000028358 MI0005456 bta-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENSCAFT00000028358 MI0005006 bta-miR-107 AGCAGCAUUGUACAGGGCUAUC
ENSCAFT00000028358 MI0005458 bta-miR-15a UAGCAGCACAUAAUGGUUUGU
ENSCAFT00000028358 MI0005459 bta-miR-195 UAGCAGCACAGAAAUAUUGGCA
ENSCAFT00000028358 MI0005040 bta-miR-214 ACAGCAGGCACAGACAGGCAGU
ENSCAFT00000028358 MI0004743 bta-miR-221 AGCUACAUUGUCUGCUGGGUUU
ENSCAFT00000028358 MI0004744 bta-miR-222 AGCUACAUCUGGCUACUGGGU
ENSCAFT00000028358 MI0005467 bta-miR-497 CAGCAGCACACUGUGGUUUGUA
ENSCAFT00000028358 MI0005023 bta-miR-545 AUCAACAAACAUUUAUUGUGUG
ENSCAFT00000028358 MI0000747 hsa-miR-296-5p AGGGCCCCCCCUCAAUCCUGU
ENSCAFT00000028358 MI0000762 hsa-miR-362-3p AACACACCUAUUCAAGGAUUCA
ENSCAFT00000028358 MI0001446 hsa-miR-424 CAGCAGCAAUUCAUGUUUUGAA
ENSCAFT00000028358 MI0002470 hsa-miR-486-5p UCCUGUACUGAGCUGCCCCGAG
ENSCAFT00000028358 MI0003142 hsa-miR-498 UUUCAAGCCAGGGGGCGUUUUUC
ENSCAFT00000028358 MI0003188 hsa-miR-503 UAGCAGCGGGAACAGUUCUGCAG
ENSCAFT00000028358 MI0003198 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENSCAFT00000028358 MI0003199 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENSCAFT00000028358 MI0003200 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENSCAFT00000028358 MI0003559 hsa-miR-554 GCUAGUCCUGACUCAGCCAGU
ENSCAFT00000028358 MI0003569 hsa-miR-563 AGGUUGACAUACGUUUCCC
ENSCAFT00000028358 MI0003589 hsa-miR-582-3p UAACUGGUUGAACAACUGAACC
ENSCAFT00000028358 MI0003617 hsa-miR-604 AGGCUGCGGAAUUCAGGAC
ENSCAFT00000028358 MI0003625 hsa-miR-612 GCUGGGCAGGGCUUCUGAGCUCCUU
ENSCAFT00000028358 MI0003631 hsa-miR-617 AGACUUCCCAUUUGAAGGUGGC
ENSCAFT00000028358 MI0003642 hsa-miR-628-5p AUGCUGACAUAUUUACUAGAGG
ENSCAFT00000028358 MI0003649 hsa-miR-634 AACCAGCACCCCAACUUUGGAC
ENSCAFT00000028358 MI0003676 hsa-miR-654-5p UGGUGGGCCGCAGAACAUGUGC
ENSCAFT00000028358 MI0005416 hsa-miR-675 UGGUGCGGAGAGGGCCCACAGUG
ENSCAFT00000028358 MI0003763 hsa-miR-767-5p UGCACCAUGGUUGUCUGAGCAUG
ENSCAFT00000028358 MI0005542 hsa-miR-876-5p UGGAUUUCUUUGUGAAUCACCA
ENSCAFT00000028358 MI0000590 mmu-miR-322 CAGCAGCAAUUCAUGUUUUGGA
ENSCAFT00000028358 MI0001526 mmu-miR-434-3p UUUGAACCAUCACUCGACUCCU
ENSCAFT00000028358 MI0005507 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENSCAFT00000028358 MI0005508 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENSCAFT00000028358 MI0005509 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENSCAFT00000028358 MI0005511 mmu-miR-466h UGUGUGCAUGUGCUUGUGUGUA
ENSCAFT00000028358 MI0004553 mmu-miR-666-3p GGCUGCAGCGUGAUCGCCUGCU
ENSCAFT00000028358 MI0004196 mmu-miR-667 UGACACCUGCCACCCAGCCCAAG
ENSCAFT00000028358 MI0004688 mmu-miR-704 AGACAUGUGCUCUGCUCCUAG
ENSCAFT00000028358 MI0004306 mmu-miR-761 GCAGCAGGGUGAAACUGACACA
ENSCAFT00000028358 MI0004215 mmu-miR-762 GGGGCUGGGGCCGGGACAGAGC
ENSCAFT00000028358 MI0004310 mmu-miR-764-3p AGGAGGCCAUAGUGGCAACUGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene