AARSD1 | GeneID:480510 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 480510 Official Symbol AARSD1
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description alanyl-tRNA synthetase domain containing 1
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 6821

ID Symbol Protein Species
GeneID:31318 CG10802 NP_570062.1 Drosophila melanogaster
GeneID:69684 Aarsd1 NP_659078.1 Mus musculus
GeneID:80755 AARSD1 NP_079543.1 Homo sapiens
GeneID:420013 AARSD1 XP_001235322.1 Gallus gallus
GeneID:445178 zgc:101066 NP_001003572.1 Danio rerio
GeneID:454704 AARSD1 XP_001157692.1 Pan troglodytes
GeneID:480510 AARSD1 XP_537630.2 Canis lupus familiaris
GeneID:510711 MGC134004 NP_001033162.1 Bos taurus
GeneID:619440 Aarsd1 NP_001029281.1 Rattus norvegicus
GeneID:855688 YNL040W NP_014358.1 Saccharomyces cerevisiae
GeneID:1272786 AgaP_AGAP003413 XP_311697.2 Anopheles gambiae
GeneID:2893329 KLLA0D02794g XP_453192.1 Kluyveromyces lactis

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_537630 XP_537630

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000023254 MI0004754 bta-miR-126 CGUACCGUGAGUAAUAAUGCG
ENSCAFT00000023254 MI0000807 hsa-miR-323-5p AGGUGGUCCGUGGCGCGUUCGC
ENSCAFT00000023254 MI0000779 hsa-miR-371-3p AAGUGCCGCCAUCUUUUGAGUGU
ENSCAFT00000023254 MI0003150 hsa-miR-526b CUCUUGAGGGAAGCACUUUCUGU
ENSCAFT00000023254 MI0005769 hsa-miR-944 AAAUUAUUGUACAUCGGAUGAG
ENSCAFT00000023254 MI0000391 mmu-miR-293 AGUGCCGCAGAGUUUGUAGUGU
ENSCAFT00000023254 MI0004649 mmu-miR-685 UCAAUGGCUGAGGUGAGGCAC
ENSCAFT00000023254 MI0004654 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENSCAFT00000023254 MI0004655 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_537630  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene