ABCA6 | GeneID:480456 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 480456 Official Symbol ABCA6
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family A (ABC1), member 6
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 71264

ID Symbol Protein Species
GeneID:23460 ABCA6 NP_525023.2 Homo sapiens
GeneID:76184 Abca6 NP_671751.1 Mus musculus
GeneID:480456 ABCA6 XP_850922.1 Canis lupus familiaris
GeneID:537351 ABCA6 XP_617513.3 Bos taurus
GeneID:742817 ABCA6 XP_001146278.1 Pan troglodytes

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_537574 XP_537574
2 XM_845829 XP_850922

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000017373 MI0004742 bta-miR-21 UAGCUUAUCAGACUGAUGUUGACU
ENSCAFT00000017373 MI0005047 bta-miR-425-5p AUGACACGAUCACUCCCGUUGA
ENSCAFT00000017373 MI0005545 hsa-miR-190b UGAUAUGUUUGAUAUUGGGUU
ENSCAFT00000017373 MI0000086 hsa-miR-28-3p CACUAGAUUGUGAGCUCCUGGA
ENSCAFT00000017373 MI0000783 hsa-miR-375 UUUGUUCGUUCGGCUCGCGUGA
ENSCAFT00000017373 MI0003576 hsa-miR-569 AGUUAAUGAAUCCUGGAAAGU
ENSCAFT00000017373 MI0003586 hsa-miR-579 UUCAUUUGGUAUAAACCGCGAUU
ENSCAFT00000017373 MI0003602 hsa-miR-590-5p GAGCUUAUUCAUAAAAGUGCAG
ENSCAFT00000017373 MI0003642 hsa-miR-628-5p AUGCUGACAUAUUUACUAGAGG
ENSCAFT00000017373 MI0003658 hsa-miR-643 ACUUGUAUGCUAGCUCAGGUAG
ENSCAFT00000017373 MI0005542 hsa-miR-876-3p UGGUGGUUUACAAAGUAAUUCA
ENSCAFT00000017373 MI0005769 hsa-miR-944 AAAUUAUUGUACAUCGGAUGAG
ENSCAFT00000017373 MI0002401 mmu-miR-466a-3p UAUACAUACACGCACACAUAAGA
ENSCAFT00000017373 MI0005504 mmu-miR-466b-3-3p AAUACAUACACGCACACAUAAGA
ENSCAFT00000017373 MI0005546 mmu-miR-466d-3p UAUACAUACACGCACACAUAG
ENSCAFT00000017373 MI0005507 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSCAFT00000017373 MI0005508 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSCAFT00000017373 MI0005509 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSCAFT00000017373 MI0003722 rno-miR-664 UAUUCAUUUACUCCCCAGCCUA
ENSCAFT00000017373 MI0003723 rno-miR-664 UAUUCAUUUACUCCCCAGCCUA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene