ABCA5 | GeneID:480455 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 480455 Official Symbol ABCA5
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family A (ABC1), member 5
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 10263

ID Symbol Protein Species
GeneID:23461 ABCA5 NP_061142.2 Homo sapiens
GeneID:217265 Abca5 NP_671752.1 Mus musculus
GeneID:286970 Abca5 NP_775429.1 Rattus norvegicus
GeneID:417444 ABCA5 XP_415695.2 Gallus gallus
GeneID:454848 ABCA5 XP_001166542.1 Pan troglodytes
GeneID:480455 ABCA5 XP_537573.2 Canis lupus familiaris
GeneID:510497 ABCA5 XP_587636.3 Bos taurus
GeneID:1272631 AgaP_AGAP010416 XP_311531.2 Anopheles gambiae
GeneID:100151075 LOC100151075 XP_001918691.1 Danio rerio

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_537573 XP_537573
2 XM_857657 XP_862750
3 XM_857680 XP_862773
4 XM_857705 XP_862798
5 XM_857730 XP_862823
6 XM_857754 XP_862847

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000017260 MI0005010 bta-miR-140 UACCACAGGGUAGAACCACGGA
ENSCAFT00000017260 MI0004738 bta-miR-151 CUAGACUGAAGCUCCUUGAGG
ENSCAFT00000017260 MI0005461 bta-miR-19b UGUGCAAAUCCAUGCAAAACUGA
ENSCAFT00000017260 MI0005017 bta-miR-218 UUGUGCUUGAUCUAACCAUGU
ENSCAFT00000017260 MI0005041 bta-miR-22-5p AGUUCUUCAGUGGCAAGCUUUA
ENSCAFT00000017260 MI0004731 bta-miR-26a UUCAAGUAAUCCAGGAUAGGCU
ENSCAFT00000017260 MI0004745 bta-miR-26b UUCAAGUAAUUCAGGAUAGGUU
ENSCAFT00000017260 MI0005054 bta-miR-30a-5p UGUAAACAUCCUCGACUGGAAGCU
ENSCAFT00000017260 MI0004761 bta-miR-30b UGUAAACAUCCUACACUCAGCU
ENSCAFT00000017260 MI0005064 bta-miR-30c UGUAAACAUCCUACACUCUCAGC
ENSCAFT00000017260 MI0004747 bta-miR-30d UGUAAACAUCCCCGACUGGAAGCU
ENSCAFT00000017260 MI0005018 bta-miR-30e-5p UGUAAACAUCCUUGACUGGAAGCU
ENSCAFT00000017260 MI0000437 hsa-miR-1 UGGAAUGUAAAGAAGUAUGUAU
ENSCAFT00000017260 MI0000651 hsa-miR-1 UGGAAUGUAAAGAAGUAUGUAU
ENSCAFT00000017260 MI0000111 hsa-miR-105 UCAAAUGCUCAGACUCCUGUGGU
ENSCAFT00000017260 MI0000112 hsa-miR-105 UCAAAUGCUCAGACUCCUGUGGU
ENSCAFT00000017260 MI0000738 hsa-miR-302a UAAGUGCUUCCAUGUUUUGGUGA
ENSCAFT00000017260 MI0000772 hsa-miR-302b UAAGUGCUUCCAUGUUUUAGUAG
ENSCAFT00000017260 MI0000773 hsa-miR-302c UAAGUGCUUCCAUGUUUCAGUGG
ENSCAFT00000017260 MI0000774 hsa-miR-302d UAAGUGCUUCCAUGUUUGAGUGU
ENSCAFT00000017260 MI0000803 hsa-miR-330-3p GCAAAGCACACGGCCUGCAGAGA
ENSCAFT00000017260 MI0003675 hsa-miR-411 UAGUAGACCGUAUAGCGUACG
ENSCAFT00000017260 MI0001729 hsa-miR-451 AAACCGUUACCAUUACUGAGUU
ENSCAFT00000017260 MI0003127 hsa-miR-511 GUGUCUUUUGCUCUGCAGUCA
ENSCAFT00000017260 MI0003128 hsa-miR-511 GUGUCUUUUGCUCUGCAGUCA
ENSCAFT00000017260 MI0003156 hsa-miR-518b CAAAGCGCUCCCCUUUAGAGGU
ENSCAFT00000017260 MI0003159 hsa-miR-518c CAAAGCGCUUCUCUUUAGAGUGU
ENSCAFT00000017260 MI0003154 hsa-miR-518f GAAAGCGCUUCUCUUUAGAGG
ENSCAFT00000017260 MI0003612 hsa-miR-548a-5p AAAAGUAAUUGCGAGUUUUACC
ENSCAFT00000017260 MI0003596 hsa-miR-548b-5p AAAAGUAAUUGUGGUUUUGGCC
ENSCAFT00000017260 MI0003630 hsa-miR-548c-3p CAAAAAUCUCAAUUACUUUUGC
ENSCAFT00000017260 MI0003668 hsa-miR-548d-5p AAAAGUAAUUGUGGUUUUUGCC
ENSCAFT00000017260 MI0003671 hsa-miR-548d-5p AAAAGUAAUUGUGGUUUUUGCC
ENSCAFT00000017260 MI0003565 hsa-miR-559 UAAAGUAAAUAUGCACCAAAA
ENSCAFT00000017260 MI0003618 hsa-miR-605 UAAAUCCCAUGGUGCCUUCUCCU
ENSCAFT00000017260 MI0003631 hsa-miR-617 AGACUUCCCAUUUGAAGGUGGC
ENSCAFT00000017260 MI0005757 hsa-miR-935 CCAGUUACCGCUUCCGCUACCGC
ENSCAFT00000017260 MI0003539 mmu-miR-291b-5p GAUCAAAGUGGAGGCCCUCUCC
ENSCAFT00000017260 MI0001526 mmu-miR-434-3p UUUGAACCAUCACUCGACUCCU
ENSCAFT00000017260 MI0002400 mmu-miR-465a-5p UAUUUAGAAUGGCACUGAUGUGA
ENSCAFT00000017260 MI0004658 mmu-miR-690 AAAGGCUAGGCUCACAACCAAA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene