ABHD3 | GeneID:480177 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 480177 Official Symbol ABHD3
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description abhydrolase domain containing 3
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 14055

ID Symbol Protein Species
GeneID:35930 CG8058 NP_610459.2 Drosophila melanogaster
GeneID:106861 Abhd3 NP_598891.1 Mus musculus
GeneID:171586 ABHD3 NP_612213.2 Homo sapiens
GeneID:180309 Y60A3A.7 NP_507863.1 Caenorhabditis elegans
GeneID:180450 C44C1.5 NP_001024458.1 Caenorhabditis elegans
GeneID:291793 Abhd3 XP_214618.4 Rattus norvegicus
GeneID:421068 ABHD3 XP_419156.2 Gallus gallus
GeneID:447830 abhd3 NP_001004569.1 Danio rerio
GeneID:480177 ABHD3 XP_537301.2 Canis lupus familiaris
GeneID:539795 ABHD3 NP_001069655.1 Bos taurus
GeneID:824243 AT3G50790 NP_190648.1 Arabidopsis thaliana
GeneID:1270246 AgaP_AGAP006819 XP_308926.2 Anopheles gambiae
GeneID:4330156 Os02g0649400 NP_001047583.1 Oryza sativa

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_537301 XP_537301

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000028985 MI0004740 bta-miR-18a UAAGGUGCAUCUAGUGCAGAUA
ENSCAFT00000028985 MI0004732 bta-miR-18b UAAGGUGCAUCUAGUGCAGUUA
ENSCAFT00000028985 MI0005015 bta-miR-20b CAAAGUGCUCACAGUGCAGGUA
ENSCAFT00000028985 MI0001647 cfa-miR-365 UAAUGCCCCUAAAAAUCCUUAU
ENSCAFT00000028985 MI0001657 cfa-miR-365 UAAUGCCCCUAAAAAUCCUUAU
ENSCAFT00000028985 MI0000450 hsa-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENSCAFT00000028985 MI0000451 hsa-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENSCAFT00000028985 MI0000238 hsa-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENSCAFT00000028985 MI0000279 hsa-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENSCAFT00000028985 MI0001150 hsa-miR-196b UAGGUAGUUUCCUGUUGUUGGG
ENSCAFT00000028985 MI0000239 hsa-miR-197 UUCACCACCUUCUCCACCCAGC
ENSCAFT00000028985 MI0005529 hsa-miR-220b CCACCACCGUGUCUGACACUU
ENSCAFT00000028985 MI0000790 hsa-miR-382 GAAGUUGUUCGUGGUGGAUUCG
ENSCAFT00000028985 MI0002464 hsa-miR-412 ACUUCACCUGGUCCACUAGCCGU
ENSCAFT00000028985 MI0003185 hsa-miR-501-3p AAUGCACCCGGGCAAGGAUUCU
ENSCAFT00000028985 MI0003186 hsa-miR-502-3p AAUGCACCUGGGCAAGGAUUCA
ENSCAFT00000028985 MI0003144 hsa-miR-515-5p UUCUCCAAAAGAAAGCACUUUCUG
ENSCAFT00000028985 MI0003147 hsa-miR-515-5p UUCUCCAAAAGAAAGCACUUUCUG
ENSCAFT00000028985 MI0003178 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENSCAFT00000028985 MI0003182 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENSCAFT00000028985 MI0003151 hsa-miR-519b-3p AAAGUGCAUCCUUUUAGAGGUU
ENSCAFT00000028985 MI0003148 hsa-miR-519c-3p AAAGUGCAUCUUUUUAGAGGAU
ENSCAFT00000028985 MI0003162 hsa-miR-519d CAAAGUGCCUCCCUUUAGAGUG
ENSCAFT00000028985 MI0003164 hsa-miR-520d-5p CUACAAAGGGAAGCCCUUUC
ENSCAFT00000028985 MI0003166 hsa-miR-520g ACAAAGUGCUUCCCUUUAGAGUGU
ENSCAFT00000028985 MI0003175 hsa-miR-520h ACAAAGUGCUUCCCUUUAGAGU
ENSCAFT00000028985 MI0003160 hsa-miR-524-5p CUACAAAGGGAAGCACUUUCUC
ENSCAFT00000028985 MI0003564 hsa-miR-558 UGAGCUGCUGUACCAAAAU
ENSCAFT00000028985 MI0003638 hsa-miR-624 CACAAGGUAUUGGUAUUACCU
ENSCAFT00000028985 MI0003640 hsa-miR-626 AGCUGUCUGAAAAUGUCUU
ENSCAFT00000028985 MI0003683 hsa-miR-659 CUUGGUUCAGGGAGGGUCCCCA
ENSCAFT00000028985 MI0005542 hsa-miR-876-3p UGGUGGUUUACAAAGUAAUUCA
ENSCAFT00000028985 MI0003539 mmu-miR-291b-3p AAAGUGCAUCCAUUUUGUUUGU
ENSCAFT00000028985 MI0002401 mmu-miR-466a-3p UAUACAUACACGCACACAUAAGA
ENSCAFT00000028985 MI0005504 mmu-miR-466b-3-3p AAUACAUACACGCACACAUAAGA
ENSCAFT00000028985 MI0005546 mmu-miR-466d-3p UAUACAUACACGCACACAUAG
ENSCAFT00000028985 MI0004666 mmu-miR-669b AGUUUUGUGUGCAUGUGCAUGU
ENSCAFT00000028985 MI0004682 mmu-miR-698 CAUUCUCGUUUCCUUCCCU
ENSCAFT00000028985 MI0004704 mmu-miR-717 CUCAGACAGAGAUACCUUCUCU
ENSCAFT00000028985 MI0005470 mmu-miR-743b-5p UGUUCAGACUGGUGUCCAUCA
ENSCAFT00000028985 MI0000644 rno-miR-352 AGAGUAGUAGGUUGCAUAGUA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_537301  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene