ACO1 | GeneID:48 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 48 Official Symbol ACO1
Locus N/A Gene Type protein-coding
Synonyms ACONS; IREB1; IREBP; IREBP1; IRP1
Full Name aconitase 1, soluble
Description aconitase 1, soluble
Chromosome 9p22-q32|9p21.1
Also Known As OTTHUMP00000021176; OTTHUMP00000021177; OTTHUMP00000045233; aconitase 1; aconitate hydratase; citrate hydro-lyase; ferritin repressor protein; iron regulatory protein 1; iron-responsive element binding protein 1
Summary Aconitase 1, also known as iron regulatory element binding protein 1 (IREB1), is a cytosolic protein which binds to iron-responsive elements (IREs). IREs are stem-loop structures found in the 5' UTR of ferritin mRNA, and in the 3' UTR of transferrin receptor mRNA. The iron-induced binding to the IRE results in repression of translation of ferritin mRNA, and inhibition of degradation of the otherwise rapidly degrading transferrin receptor mRNA. Thus, IREB1 plays a central role in cellular iron homeostasis. It was also shown to have aconitase activity, and hence grouped with the aconitase family of enzymes. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 1657

ID Symbol Protein Species
GeneID:48 ACO1 NP_002188.1 Homo sapiens
GeneID:11428 Aco1 NP_031412.2 Mus musculus
GeneID:41269 Irp-1B NP_524303.2 Drosophila melanogaster
GeneID:42689 Irp-1A NP_477371.1 Drosophila melanogaster
GeneID:50655 Aco1 NP_059017.1 Rattus norvegicus
GeneID:181324 aco-1 NP_509898.1 Caenorhabditis elegans
GeneID:373916 ACO1 NP_001025707.1 Gallus gallus
GeneID:465034 ACO1 XP_520523.2 Pan troglodytes
GeneID:481576 ACO1 XP_538698.2 Canis lupus familiaris
GeneID:512995 ACO1 NP_001069059.1 Bos taurus
GeneID:568448 aco1 NP_001030155.1 Danio rerio
GeneID:814196 PF13_0229 XP_001350142.1 Plasmodium falciparum
GeneID:815120 AT2G05710 NP_178634.2 Arabidopsis thaliana
GeneID:828805 AT4G26970 NP_567763.1 Arabidopsis thaliana
GeneID:829737 AT4G35830 NP_195308.1 Arabidopsis thaliana
GeneID:1269890 AgaP_AGAP007258 XP_308544.2 Anopheles gambiae
GeneID:4331547 Os03g0136900 NP_001048898.1 Oryza sativa

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab62451 Aconitase 1 (phospho S711) antibody (ab62451); Rabbit polyclonal to Aconitase 1 (phospho S711)
2 abcam ab63260 Aconitase 1 (phospho S138) antibody (ab63260); Rabbit polyclonal to Aconitase 1 (phospho S138)
3 abcam ab62701 Aconitase 1 antibody (ab62701); Rabbit polyclonal to Aconitase 1
4 abcam ab61197 Aconitase 1 antibody (ab61197); Rabbit polyclonal to Aconitase 1
5 abcam ab54718 Aconitase 1 antibody (ab54718); Mouse monoclonal to Aconitase 1
6 abnova H00000048-M01 ACO1 monoclonal antibody (M01), clone 2C1; Mouse monoclonal antibody raised against a partial recombinant ACO1.
7 scbt ACO1 ACO1 Antibody / ACO1 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ACO1 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ACO1 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005829 Component cytosol
GO:0005783 Component endoplasmic reticulum
GO:0005794 Component Golgi apparatus
GO:0051539 Function 4 iron, 4 sulfur cluster binding
GO:0003994 Function aconitate hydratase activity
GO:0005506 Function iron ion binding
GO:0016829 Function lyase activity
GO:0046872 Function metal ion binding
GO:0003723 Function RNA binding
GO:0006101 Process citrate metabolic process
GO:0008152 Process metabolic process
GO:0006099 Process tricarboxylic acid cycle

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_002197  UCSC Browser NP_002188 P21399   Q5VZA7  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000379923 MI0000102 hsa-miR-100* CAAGCUUGUAUCUAUAGGUAUG
ENST00000379923 MI0000442 hsa-miR-122 UGGAGUGUGACAAUGGUGUUUG
ENST00000379923 MI0000455 hsa-miR-138 AGCUGGUGUUGUGAAUCAGGCCG
ENST00000379923 MI0000476 hsa-miR-138 AGCUGGUGUUGUGAAUCAGGCCG
ENST00000379923 MI0000457 hsa-miR-141 UAACACUGUCUGGUAAAGAUGG
ENST00000379923 MI0000479 hsa-miR-150 UCUCCCAACCCUUGUACCAGUG
ENST00000379923 MI0000482 hsa-miR-185 UGGAGAGAAAGGCAGUUCCUGA
ENST00000379923 MI0000234 hsa-miR-192 CUGACCUAUGAAUUGACAGCC
ENST00000379923 MI0000737 hsa-miR-200a UAACACUGUCUGGUAACGAUGU
ENST00000379923 MI0000291 hsa-miR-215 AUGACCUAUGAAUUGACAGAC
ENST00000379923 MI0000080 hsa-miR-24-1* UGCCUACUGAGCUGAUAUCAGU
ENST00000379923 MI0000087 hsa-miR-29a UAGCACCAUCUGAAAUCGGUUA
ENST00000379923 MI0000105 hsa-miR-29b UAGCACCAUUUGAAAUCAGUGUU
ENST00000379923 MI0000107 hsa-miR-29b UAGCACCAUUUGAAAUCAGUGUU
ENST00000379923 MI0000735 hsa-miR-29c UAGCACCAUUUGAAAUCGGUUA
ENST00000379923 MI0000772 hsa-miR-302b* ACUUUAACAUGGAAGUGCUUUC
ENST00000379923 MI0000773 hsa-miR-302c* UUUAACAUGGGGGUACCUGCUG
ENST00000379923 MI0000774 hsa-miR-302d* ACUUUAACAUGGAGGCACUUGC
ENST00000379923 MI0003132 hsa-miR-493 UGAAGGUCUACUGUGUGCCAGG
ENST00000379923 MI0003198 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENST00000379923 MI0003199 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENST00000379923 MI0003200 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENST00000379923 MI0003180 hsa-miR-516a-3p UGCUUCCUUUCAGAGGGU
ENST00000379923 MI0003181 hsa-miR-516a-3p UGCUUCCUUUCAGAGGGU
ENST00000379923 MI0003156 hsa-miR-518b CAAAGCGCUCCCCUUUAGAGGU
ENST00000379923 MI0003159 hsa-miR-518c CAAAGCGCUUCUCUUUAGAGUGU
ENST00000379923 MI0003171 hsa-miR-518d-3p CAAAGCGCUUCCCUUUGGAGC
ENST00000379923 MI0003154 hsa-miR-518f GAAAGCGCUUCUCUUUAGAGG
ENST00000379923 MI0003148 hsa-miR-519c-3p AAAGUGCAUCUUUUUAGAGGAU
ENST00000379923 MI0003588 hsa-miR-581 UCUUGUGUUCUCUAGAUCAGU
ENST00000379923 MI0003590 hsa-miR-583 CAAAGAGGAAGGUCCCAUUAC
ENST00000379923 MI0003602 hsa-miR-590-3p UAAUUUUAUGUAUAAGCUAGU
ENST00000379923 MI0003604 hsa-miR-592 UUGUGUCAAUAUGCGAUGAUGU
ENST00000379923 MI0003605 hsa-miR-593* AGGCACCAGCCAGGCAUUGCUCAGC
ENST00000379923 MI0003607 hsa-miR-595 GAAGUGUGCCGUGGUGUGUCU
ENST00000379923 MI0003609 hsa-miR-597 UGUGUCACUCGAUGACCACUGU
ENST00000379923 MI0003642 hsa-miR-628-5p AUGCUGACAUAUUUACUAGAGG
ENST00000379923 MI0003643 hsa-miR-629* GUUCUCCCAACGUAAGCCCAGC
ENST00000379923 MI0003651 hsa-miR-636 UGUGCUUGCUCGUCCCGCCCGCA
ENST00000379923 MI0003663 hsa-miR-648 AAGUGUGCAGGGCACUGGU
ENST00000379923 MI0005541 hsa-miR-875-3p CCUGGAAACACUGAGGUUGUG
ENST00000379923 MI0000098 hsa-miR-96 UUUGGCACUAGCACAUUUUUGCU
ENST00000379923 MI0002637 mml-miR-189 GUGCCUACUGAGCUGAUAUCAGU
ENST00000379923 MI0002399 mmu-miR-464 UACCAAGUUUAUUCUGUGAGAUA
ENST00000379923 MI0005511 mmu-miR-466h UGUGUGCAUGUGCUUGUGUGUA
ENST00000379923 MI0005003 mmu-miR-676 CCGUCCUGAGGUUGUUGAGCU
ENST00000379923 MI0004310 mmu-miR-764-5p GGUGCUCACAUGUCCUCCU
ENST00000379923 MI0005477 mmu-miR-883b-5p UACUGAGAAUGGGUAGCAGUCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

AB209480   AF261088   AK057904   AK308752   BC018103   DA409113   M58510   NM_002197   Z11559  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

AAA69900   AAF99681   AAH18103   ABF47095   BAD92717   CAA77651   CAH72598   CAH72599   EAW58549   EAW58550   EAW58551   EAW58552   NP_002188   P21399   Q59FI0   Q5VZA6   Q5VZA7   Q9HBB2  

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
2-nitrofluorene
  • 2-nitrofluorene results in increased expression of ACO1 mRNA
15890375
4-(N-methyl-N-nitrosamino)-1-(3-pyridyl)-1-butanone
  • 4-(N-methyl-N-nitrosamino)-1-(3-pyridyl)-1-butanone results in increased expression of ACO1 mRNA
15890375
Acetaminophen
  • Acetaminophen affects the expression of ACO1 mRNA
17562736
Aflatoxin B1
  • Aflatoxin B1 results in increased expression of ACO1 mRNA
15890375
Aluminum
  • Aluminum results in decreased activity of ACO1 protein
10806405
Aluminum
  • Aluminum does not affect the activity of ACO1 protein
16386771
Arsenic
  • Arsenic results in increased activity of ACO1 protein
16386771
Cadmium
  • Cadmium does not affect the activity of ACO1 protein
16386771
Chromium
  • Chromium does not affect the activity of ACO1 protein
16386771
Clofibric Acid
  • Clofibric Acid affects the expression of ACO1 mRNA
17602206
Cobalt
  • Cobalt results in increased activity of ACO1 protein
16877034, 16386771
Copper
  • Copper results in increased activity of ACO1 protein
16386771
coumarin
  • coumarin affects the expression of ACO1 mRNA
16963487
Deferoxamine
  • Deferoxamine results in increased activity of ACO1 protein
16568477
Dietary Fats
  • Dietary Fats results in decreased expression of ACO1 mRNA
18042831
Diethylstilbestrol
  • Diethylstilbestrol results in increased expression of ACO1 mRNA
15890375
Dimethylnitrosamine
  • Dimethylnitrosamine results in decreased expression of ACO1 mRNA
15890375
Doxorubicin
  • Doxorubicin does not affect the activity of ACO1 protein
16770644
Estradiol
  • Estradiol affects the expression of ACO1 mRNA
16684588
Ethanol
  • Ethanol does not affect the activity of ACO1 protein
16737972
ferric sulfate
  • ferric sulfate inhibits the reaction [Nickel results in increased activity of ACO1 protein]
16877034
fluorocitrate
  • fluorocitrate results in decreased activity of ACO1 protein
17469137
Hemin
  • Hemin results in decreased activity of ACO1 protein
16568477
Hydrogen Peroxide
  • Hydrogen Peroxide results in increased activity of ACO1 protein
15664434
Iron
  • ACO1 protein affects the metabolism of Iron
17194590
Iron
  • Iron inhibits the reaction [Nickel results in increased activity of ACO1 protein]
16877034
Lead
  • Lead does not affect the activity of ACO1 protein
16386771
Manganese
  • Manganese results in decreased activity of ACO1 protein
17469137
Manganese
  • Manganese results in increased stability of [ACO1 protein binds to SLC11A2 mRNA]
16729984
Manganese
  • Manganese results in increased activity of ACO1 protein
16568477, 16545456
Manganese
  • Manganese results in increased activity of ACO1 protein
16386771
manganese chloride
  • manganese chloride results in increased activity of ACO1 protein
16568477, 16545456
Mercury
  • Mercury does not affect the activity of ACO1 protein
16386771
Methapyrilene
  • Methapyrilene results in increased expression of ACO1 mRNA
15890375
Nickel
  • Nickel results in increased activity of ACO1 protein
16877034, 16386771
Nickel
  • Iron inhibits the reaction [Nickel results in increased activity of ACO1 protein]
  • ferric sulfate inhibits the reaction [Nickel results in increased activity of ACO1 protein]
16877034
nickel chloride
  • nickel chloride results in decreased activity of ACO1 protein
17018869
nickel chloride
  • nickel chloride results in increased activity of ACO1 protein
16649251
nickel sulfate
  • nickel sulfate results in decreased expression of ACO1 mRNA
16780908
Nitric Oxide
  • Nitric Oxide results in decreased expression of ACO1 mRNA
  • STAT5A protein affects the reaction [Nitric Oxide results in decreased expression of ACO1 mRNA]
  • STAT5B protein affects the reaction [Nitric Oxide results in decreased expression of ACO1 mRNA]
16886906
palm oil
  • palm oil results in decreased expression of ACO1 mRNA
18042831
Paraquat
  • Paraquat results in decreased activity of ACO1 protein
11814328
Paraquat
  • Paraquat results in decreased activity of ACO1 protein
17324120, 11520895
Paraquat
  • Paraquat results in increased activity of ACO1 protein
15664434
Piperonyl Butoxide
  • Piperonyl Butoxide results in increased expression of ACO1 mRNA
15890375
pirinixic acid
  • pirinixic acid results in increased expression of ACO1 mRNA
16940010, 15890375
tert-Butylhydroperoxide
  • tert-Butylhydroperoxide results in increased expression of ACO1 mRNA
15336504
Vanadium
  • Vanadium results in increased activity of ACO1 protein
16386771
Zinc
  • Zinc does not affect the activity of ACO1 protein
16386771

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Acrodermatitis inferred via Zinc 17190629, 17202136, 16889938
Alzheimer Disease inferred via Zinc 17119284, 16580781, 16325427, 16410023
Anemia, Sickle Cell inferred via Zinc 16916123
Asthma inferred via Zinc 17085522
Brain Injuries inferred via Zinc 17109824
Carcinoma, Squamous Cell inferred via Zinc 16543248
Cardiovascular Diseases inferred via Zinc 16936243
Diabetes Mellitus inferred via Zinc 16479319
Esophageal Neoplasms inferred via Zinc 16543248
Gastritis inferred via Zinc 17241300
Growth Disorders inferred via Zinc 17217573
Heart Failure inferred via Zinc 17162251
Heart Injuries inferred via Zinc 17074742
Helicobacter Infections inferred via Zinc 17241300
Hepatolenticular Degeneration inferred via Zinc 17276780
Ischemia inferred via Zinc 16584753
Kidney Diseases inferred via Zinc 16960431
Kidney Failure, Chronic inferred via Zinc 16518626
Mammary Neoplasms, Experimental inferred via Zinc 12773700
Pre-Eclampsia inferred via Zinc 17114810
Prostatic Neoplasms inferred via Zinc 12429649, 16517595, 16700911, 16606632
Retinal Degeneration inferred via Zinc 16584753
Tongue Neoplasms inferred via Zinc 16543248
Carcinoma, Hepatocellular inferred via Vanadium 16878318
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375
Liver Neoplasms inferred via Piperonyl Butoxide 15890375, 18648771
Agricultural Workers' Diseases inferred via Paraquat 11874814
Gliosis inferred via Paraquat 11124998
Nerve Degeneration inferred via Paraquat 16893418
Parkinson Disease inferred via Paraquat 12911755, 15824117, 11445065, 15451049, 16510128, 11124998, 16140633, 11181820
Pneumonia inferred via Paraquat 12504350
Pulmonary Fibrosis inferred via Paraquat 16324872, 17997886
Respiratory Distress Syndrome, Adult inferred via Paraquat 11700416
Respiratory Sounds inferred via Paraquat 11874814
Retinal Degeneration inferred via Paraquat 16458197
Alzheimer Disease inferred via Nitric Oxide 17556102
Breast Neoplasms inferred via Nitric Oxide 15631943
Cholestasis inferred via Nitric Oxide 16919318
Dementia, Vascular inferred via Nitric Oxide 17556102
Hypertension, Pulmonary inferred via Nitric Oxide 15838368
Intestinal Diseases inferred via Nitric Oxide 10210152
Lymphoma inferred via Nitric Oxide 16166326
Dermatitis, Allergic Contact inferred via nickel sulfate 16780908
Breast Neoplasms inferred via Nickel 15986119
Dermatitis, Allergic Contact inferred via Nickel 17244072, 17100760
HIV Infections inferred via Nickel 17263646
Liver Neoplasms inferred via Methapyrilene 15890375
Autoimmune Diseases inferred via Mercury 16634805
Anemia, Sideroblastic inferred via manganese chloride 16910769
Anemia, Sideroblastic inferred via Manganese 16910769
Glioblastoma inferred via Manganese 17043766
Manganese Poisoning inferred via Manganese 16551646, 16568477
Movement Disorders inferred via Manganese 16551646
Nerve Degeneration inferred via Manganese 16551646
Parkinson Disease inferred via Manganese 11181820
Parkinsonian Disorders inferred via Manganese 16140633
Dementia inferred via Lead 16140633
Essential Tremor inferred via Lead 18007985
Infertility, Male inferred via Lead 16780224
Lead Poisoning inferred via Lead 16700817
Learning Disorders inferred via Lead 16384672
Memory Disorders inferred via Lead 17263510, 16384672
Prenatal Exposure Delayed Effects inferred via Lead 16384672
alpha 1-Antitrypsin Deficiency inferred via Iron 16640825
Alzheimer Disease inferred via Iron 16640825, 16563566
Anemia inferred via Iron 16566752, 16434484
Anemia, Iron-Deficiency inferred via Iron 17162259, 17375513, 16569441, 17147795, 17163184
Anemia, Sideroblastic inferred via Iron 16910769
Arrhythmias, Cardiac inferred via Iron 16604332
Atherosclerosis inferred via Iron 16640825, 16632123
Bacterial Infections inferred via Iron 16640825
Cardiomyopathies inferred via Iron 16640825
Cardiomyopathy, Dilated inferred via Iron 16604332
Colonic Neoplasms inferred via Iron 16640825
Diabetes Mellitus inferred via Iron 16640825, 16604332
Diabetes Mellitus, Type 1 inferred via Iron 16506275
Diabetes Mellitus, Type 2 inferred via Iron 16506275
Fatty Liver inferred via Iron 16640825
Friedreich Ataxia inferred via Iron 16640825, 16604332
Hemochromatosis inferred via Iron 17236123, 16604332, 16574947, 16640825, 17255318, 17053826
Hemosiderosis inferred via Iron 16604332
Hepatitis, Viral, Human inferred via Iron 16640825
Hepatolenticular Degeneration inferred via Iron 17182432
Hepatomegaly inferred via Iron 16890145
HIV Infections inferred via Iron 16597321
Hypogonadism inferred via Iron 16640825
Hypothyroidism inferred via Iron 16640825
Iron Metabolism Disorders inferred via Iron 17163184
Lewy Body Disease inferred via Iron 16563566
Liver Cirrhosis inferred via Iron 16640825
Liver Diseases, Alcoholic inferred via Iron 17207112, 16737972
Liver Neoplasms inferred via Iron 16640825
Lung Neoplasms inferred via Iron 16640825
Macular Degeneration inferred via Iron 16640825
Multiple Sclerosis, Chronic Progressive inferred via Iron 17086897
Mycoses inferred via Iron 16640825
Myocardial Ischemia inferred via Iron 16604332
Myocardial Reperfusion Injury inferred via Iron 16604332
Nephrotic Syndrome inferred via Iron 17178036
Neurodegenerative Diseases inferred via Iron 17296847, 16604332
Osteoarthritis inferred via Iron 16640825
Osteoporosis inferred via Iron 16640825, 16648989
Parkinson Disease inferred via Iron 16640825, 16563566
Pituitary Diseases inferred via Iron 16604332
Poisoning inferred via Iron 16604332
Porphyria Cutanea Tarda inferred via Iron 16640825
Pre-Eclampsia inferred via Iron 16640825
Protozoan Infections inferred via Iron 16640825
Restless Legs Syndrome inferred via Iron 16930377
Sudden Infant Death inferred via Iron 16640825
Tuberculosis inferred via Iron 16597321
Cardiovascular Diseases inferred via Hydrogen Peroxide 16936243
Kidney Failure, Chronic inferred via Hydrogen Peroxide 16518626
Liver Diseases inferred via Hemin 17173083
Burns inferred via Ethanol 16374292
Carcinoma, Hepatocellular inferred via Ethanol 15763234, 15289165
Esophageal Neoplasms inferred via Ethanol 16704527
Fatty Liver inferred via Ethanol 16409862
Fatty Liver, Alcoholic inferred via Ethanol 17920746
Fetal Alcohol Syndrome inferred via Ethanol 16946407
Hepatitis, Toxic inferred via Ethanol 11566570
Liver Cirrhosis inferred via Ethanol 15289165
Liver Cirrhosis, Alcoholic inferred via Ethanol 18295389
Liver Cirrhosis, Experimental inferred via Ethanol 18166357
Liver Diseases, Alcoholic inferred via Ethanol 17207112, 17347304
Breast Neoplasms inferred via Estradiol 17289903, 14630087, 18497071, 17018787, 17261762, 12948864
Candidiasis, Vulvovaginal inferred via Estradiol 16111702
Carcinoma, Hepatocellular inferred via Estradiol 16924424
Herpes Genitalis inferred via Estradiol 15709030
Hot Flashes inferred via Estradiol 17088409
Insulin Resistance inferred via Estradiol 16393666, 16627594
Kidney Diseases inferred via Estradiol 15618244
Kidney Neoplasms inferred via Estradiol 15610895
Liver Cirrhosis, Experimental inferred via Estradiol 14716833, 14659978
Mammary Neoplasms, Experimental inferred via Estradiol 17203775, 11807958, 11408345, 16891317
Myocardial Reperfusion Injury inferred via Estradiol 16810080
Neovascularization, Pathologic inferred via Estradiol 17289903
Prostatic Neoplasms inferred via Estradiol 16740699
Adenocarcinoma inferred via Doxorubicin 17418594
Bone Marrow Neoplasms inferred via Doxorubicin 14601052
Brain Neoplasms inferred via Doxorubicin 17150277
Breast Neoplasms inferred via Doxorubicin 15692762, 15136595, 11325840, 16322301, 16096432, 15993339, 15634643, 15567936, 15994142, 15668708, 16264153, 18234424, 17369602, 16935488, 18382427, 15939500, 17426702, 17983394, 18628466, 16826403
Carcinoid Tumor inferred via Doxorubicin 16051944
Carcinoma, Hepatocellular inferred via Doxorubicin 18059187, 17876044, 16234567, 16023760
Carcinoma, Renal Cell inferred via Doxorubicin 16201981
Cardiomyopathies inferred via Doxorubicin 16952015, 17007740, 15811867, 17382496, 16731534, 18627295, 17131338, 16651473, 15505089, 16278810, 15476868, 16269455, 16109756, 16242529, 16364871, 17351982, 16455267, 17329180, 17974986, 17308081
Cardiomyopathy, Dilated inferred via Doxorubicin 17334414, 16243910
Colorectal Neoplasms inferred via Doxorubicin 18259882
Drug Toxicity inferred via Doxorubicin 18602426
Endometrial Neoplasms inferred via Doxorubicin 17359293
Endomyocardial Fibrosis inferred via Doxorubicin 18037988
Glioblastoma inferred via Doxorubicin 17150277
Head and Neck Neoplasms inferred via Doxorubicin 15692506
Heart Diseases inferred via Doxorubicin 16707910, 16244371, 16244372, 16144979, 16879835, 16330681
Hemangiosarcoma inferred via Doxorubicin 15692506
Hepatitis, Toxic inferred via Doxorubicin 17416283
Hodgkin Disease inferred via Doxorubicin 17606976, 18501091, 15147373
Kidney Diseases inferred via Doxorubicin 16775033, 15369732
Kidney Failure inferred via Doxorubicin 17922066
Kidney Failure, Chronic inferred via Doxorubicin 16707910
Leukemia, Erythroblastic, Acute inferred via Doxorubicin 16085563
Liver Cirrhosis, Experimental inferred via Doxorubicin 16595196, 16439617
Liver Neoplasms, Experimental inferred via Doxorubicin 17085340, 16842330
Lung Neoplasms inferred via Doxorubicin 17418594
Lymphoma inferred via Doxorubicin 16098063
Lymphoma, Non-Hodgkin inferred via Doxorubicin 17654614
Lymphoma, T-Cell inferred via Doxorubicin 15621674
Mammary Neoplasms, Experimental inferred via Doxorubicin 15458769
Melanoma inferred via Doxorubicin 16827129
Mucositis inferred via Doxorubicin 17415656
Neoplasm Metastasis inferred via Doxorubicin 18259882
Nephrotic Syndrome inferred via Doxorubicin 15640375, 16889571
Neuroblastoma inferred via Doxorubicin 15555623
Osteosarcoma inferred via Doxorubicin 15930896
Phyllodes Tumor inferred via Doxorubicin 17983394
Prostatic Neoplasms inferred via Doxorubicin 15897917, 15749863, 18437689, 16729912, 16888761, 16868541
Sarcoma inferred via Doxorubicin 18313854, 17710206, 17203757, 16767912, 15675481, 15625365
Sarcoma, Ewing's inferred via Doxorubicin 14601052, 16326096
Sarcoma, Kaposi inferred via Doxorubicin 17846226
Skin Neoplasms inferred via Doxorubicin 15692506
Soft Tissue Neoplasms inferred via Doxorubicin 16767912, 15625365, 17203757
Thyroid Neoplasms inferred via Doxorubicin 17909728, 16010429
Urinary Bladder Neoplasms inferred via Doxorubicin 17653716
Ventricular Dysfunction, Left inferred via Doxorubicin 17334414, 16364871
Adenocarcinoma inferred via Dimethylnitrosamine 16033868
Carcinoma, Squamous Cell inferred via Dimethylnitrosamine 16033868
Esophageal Neoplasms inferred via Dimethylnitrosamine 17016578
Liver Cirrhosis, Experimental inferred via Dimethylnitrosamine 17203207, 14659978, 15798949, 15571005, 15161499, 12918455, 15298665, 16042886, 15479170, 17196135, 15383259, 15366600, 17348192, 17201889, 18237412, 17719030, 15081153, 16169303, 14643895, 18567088, 14709902, 15577212, 15504291, 17666798, 15138612, 16603200, 17724770, 15723089, 14726149, 16627068, 15942678, 15744066, 15591649, 18239293, 16270385, 17881167, 15492853, 18629640, 15864749, 15763062, 16544323, 15842777, 15793283, 18371158, 12925901, 15733078, 16009107, 18637143, 18672772, 15067225, 17640959, 18364076, 15369754, 15099470, 15339415, 17432682, 17198567, 15086199, 14568256, 18210741, 17465448, 18095165, 16570917, 17036385, 17534399
Liver Failure, Acute inferred via Dimethylnitrosamine 17457977
Liver Neoplasms inferred via Dimethylnitrosamine 3113478, 15890375
Liver Neoplasms, Experimental inferred via Dimethylnitrosamine 15603536
Lung Neoplasms inferred via Dimethylnitrosamine 16061637
Stomach Neoplasms inferred via Dimethylnitrosamine 16033868
Amyloidosis inferred via Diethylstilbestrol 15469931
Breast Neoplasms inferred via Diethylstilbestrol 15324884, 17129689
Carcinoma, Hepatocellular inferred via Diethylstilbestrol 16924424, 15948411
Cryptorchidism inferred via Diethylstilbestrol 12952375, 16002989
Endometrial Hyperplasia inferred via Diethylstilbestrol 16402032
Endometrial Neoplasms inferred via Diethylstilbestrol 15700306, 16804899
Female Urogenital Diseases inferred via Diethylstilbestrol 16513791, 16002989, 15751030, 16611131, 16534752
Genital Neoplasms, Female inferred via Diethylstilbestrol 16452187
Hyperplasia inferred via Diethylstilbestrol 12960047, 14722030
Hypospadias inferred via Diethylstilbestrol 16002989
Infertility inferred via Diethylstilbestrol 15036965
Kidney Neoplasms inferred via Diethylstilbestrol 15003126, 14681315, 16762066
Liver Neoplasms inferred via Diethylstilbestrol 16712894, 15890375
Lupus Nephritis inferred via Diethylstilbestrol 15166399
Lymphoma inferred via Diethylstilbestrol 15700306
Male Urogenital Diseases inferred via Diethylstilbestrol 16002989
Neoplasms inferred via Diethylstilbestrol 15313581
Pituitary Diseases inferred via Diethylstilbestrol 14722030
Pituitary Neoplasms inferred via Diethylstilbestrol 15687265, 16977796
Prostatic Neoplasms inferred via Diethylstilbestrol 15846301, 17136230, 15046698
Spermatocele inferred via Diethylstilbestrol 16709447, 16002989
Urinary Bladder Neoplasms inferred via Diethylstilbestrol 16712894, 16452187
Uterine Cervical Neoplasms inferred via Diethylstilbestrol 16175088
Uterine Diseases inferred via Diethylstilbestrol 14652134
Uterine Neoplasms inferred via Diethylstilbestrol 15809267, 16690809
Vaginal Neoplasms inferred via Diethylstilbestrol 16513791, 16002989
Arteriosclerosis inferred via Dietary Fats 15238619
Dyslipidemias inferred via Dietary Fats 18367378
Insulin Resistance inferred via Dietary Fats 18457598
Obesity inferred via Dietary Fats 18457598, 17217161
Breast Neoplasms inferred via Deferoxamine 15993339
Alzheimer Disease inferred via Copper 17119284, 16866297, 16325427, 16410023, 16962711, 16886094
Amyotrophic Lateral Sclerosis inferred via Copper 10694572
Anemia, Iron-Deficiency inferred via Copper 16614410
Brain Neoplasms inferred via Copper 17079463
Breast Neoplasms inferred via Copper 15986119, 17079463
Cardiomegaly inferred via Copper 17327471
Hepatitis, Chronic inferred via Copper 17338147
Hepatolenticular Degeneration inferred via Copper 17109627, 17182432, 16607473, 17276780
Kidney Failure, Chronic inferred via Copper 16518626
Learning Disorders inferred via Copper 17134702
Menkes Kinky Hair Syndrome inferred via Copper 17109627, 17268249
Neovascularization, Pathologic inferred via Copper 17308104
Prostatic Neoplasms inferred via Copper 17079463, 17308104
Schizophrenia inferred via Copper 16842975
Breast Neoplasms inferred via Cobalt 15986119
Hypertension inferred via Cobalt 17039479
Liver Neoplasms inferred via Clofibric Acid 17602206
Breast Neoplasms inferred via Chromium 15986119
Cell Transformation, Neoplastic inferred via Cadmium 17332340
Kidney Diseases inferred via Cadmium 16962696, 16322080
Prostatic Neoplasms inferred via Cadmium 17075824
Arsenic Poisoning inferred via Arsenic 16251483, 16835338, 12569548
Atherosclerosis inferred via Arsenic 12928151
Carcinoma, Basal Cell inferred via Arsenic 15504454
Carcinoma, Hepatocellular inferred via Arsenic 16507464
Carcinoma, Squamous Cell inferred via Arsenic 15504454
Cardiovascular Diseases inferred via Arsenic 15738583
Carotid Artery Diseases inferred via Arsenic 16973168
Foot Diseases inferred via Arsenic 6392382
Hypertension inferred via Arsenic 9931084, 11953799
Keratosis inferred via Arsenic 17050553, 16930632, 12749816
Leukemia, Promyelocytic, Acute inferred via Arsenic 17339181
Liver Diseases inferred via Arsenic 11134558
Liver Neoplasms inferred via Arsenic 16368122
Myocardial Ischemia inferred via Arsenic 15371236
Neural Tube Defects inferred via Arsenic 16620997
Neurogenic Inflammation inferred via Arsenic 17056641
Peripheral Vascular Diseases inferred via Arsenic 15371236, 6392382, 16905509
Prostatic Neoplasms inferred via Arsenic 16140617
Skin Diseases inferred via Arsenic 17050553, 16759981, 16353154, 6392382, 15952646
Skin Neoplasms inferred via Arsenic 16251483, 17050553, 15504454, 17029826
Urinary Bladder Neoplasms inferred via Arsenic 15987713, 11144890
Vascular Diseases inferred via Arsenic 17056641
Alzheimer Disease inferred via Aluminum 10721010
Inflammation inferred via Aluminum 16052892
Lung Diseases inferred via Aluminum 16052892
Multiple Sclerosis, Chronic Progressive inferred via Aluminum 17086897
Multiple Sclerosis, Relapsing-Remitting inferred via Aluminum 17086897
Carcinoma, Hepatocellular inferred via Aflatoxin B1 12619106
Liver Neoplasms inferred via Aflatoxin B1 2125692, 15890375
Lung Neoplasms inferred via Aflatoxin B1 14755239
Hepatitis, Toxic inferred via Acetaminophen 2444490, 17522070, 16081117, 14986274, 16227642, 15968718, 16177239, 17562736
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215
Liver Neoplasms inferred via 4-(N-methyl-N-nitrosamino)-1-(3-pyridyl)-1-butanone 15890375
Lung Neoplasms inferred via 4-(N-methyl-N-nitrosamino)-1-(3-pyridyl)-1-butanone 16061637, 16401635, 14755239, 15172992, 12438228
Liver Neoplasms inferred via 2-nitrofluorene 15890375

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Gu JM, et al. (2008) "HBx modulates iron regulatory protein 1-mediated iron metabolism via reactive oxygen species." Virus Res. 133(2):167-177. PMID:18262302
  2. [ + ] Jenkins ZA, et al. (2007) "Iron homeostasis during transfusional iron overload in beta-thalassemia and sickle cell disease: changes in iron regulatory protein, hepcidin, and ferritin expression." Pediatr Hematol Oncol. 24(4):237-243. PMID:17613866
  3. [ + ] Chen G, et al. (2007) "Overexpression of iron regulatory protein 1 suppresses growth of tumor xenografts." Carcinogenesis. 28(4):785-791. PMID:17127713
  4. [ + ] Popovic Z, et al. (2007) "Inhibition of an iron-responsive element/iron regulatory protein-1 complex by ATP binding and hydrolysis." FEBS J. 274(12):3108-3119. PMID:17521334
  5. [ + ] Martelli A, et al. (2007) "Folding and turnover of human iron regulatory protein 1 depend on its subcellular localization." FEBS J. 274(4):1083-1092. PMID:17244191
  6. [ + ] Christova T, et al. (2007) "Effect of hypoxia on the binding and subcellular distribution of iron regulatory proteins." Mol Cell Biochem. 301(1-2):21-32. PMID:17200797
  7. [ + ] Wang W, et al. (2007) "Excess capacity of the iron regulatory protein system." J Biol Chem. 282(34):24650-24659. PMID:17604281
  8. [ + ] Dupuy J, et al. (2006) "Crystal structure of human iron regulatory protein 1 as cytosolic aconitase." Structure. 14(1):129-139. PMID:16407072
  9. [ + ] Li K, et al. (2006) "Roles of the mammalian cytosolic cysteine desulfurase, ISCS, and scaffold protein, ISCU, in iron-sulfur cluster assembly." J Biol Chem. 281(18):12344-12351. PMID:16527810
  10. [ + ] Recalcati S, et al. (2006) "Iron regulatory proteins 1 and 2 in human monocytes, macrophages and duodenum: expression and regulation in hereditary hemochromatosis and iron deficiency." Haematologica. 91(3):303-310. PMID:16503547
  11. [ + ] Clarke SL, et al. (2006) "Iron-responsive degradation of iron-regulatory protein 1 does not require the Fe-S cluster." EMBO J. 25(3):544-553. PMID:16424901
  12. [ + ] Kimura K, et al. (2006) "Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes." Genome Res. 16(1):55-65. PMID:16344560
  13. [ + ] Patton SM, et al. (2005) "Subcellular localization of iron regulatory proteins to Golgi and ER membranes." J Cell Sci. 118(Pt 19):4365-4373. PMID:16144863
  14. [ + ] Yikilmaz E, et al. (2005) "Self-association and ligand-induced conformational changes of iron regulatory proteins 1 and 2." Biochemistry. 44(23):8470-8478. PMID:15938636
  15. [ + ] Vidal R, et al. (2004) "Intracellular ferritin accumulation in neural and extraneural tissue characterizes a neurodegenerative disease associated with a mutation in the ferritin light polypeptide gene." J Neuropathol Exp Neurol. 63(4):363-380. PMID:15099026
  16. [ + ] Gail M, et al. (2004) "Transferrin receptor induction in Toxoplasma gondii-infected HFF is associated with increased iron-responsive protein 1 activity and is mediated by secreted factors." Parasitol Res. 94(3):233-239. PMID:15349772
  17. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  18. [ + ] Popovic Z, et al. (2004) "Iron accumulation and iron-regulatory protein activity in human hepatoma (HepG2) cells." Mol Cell Biochem. 265(1-2):37-45. PMID:15543932
  19. [ + ] Fillebeen C, et al. (2003) "A phosphomimetic mutation at Ser-138 renders iron regulatory protein 1 sensitive to iron-dependent degradation." Mol Cell Biol. 23(19):6973-6981. PMID:12972614
  20. [ + ] Schneider BD, et al. (2003) "Effects of iron regulatory protein regulation on iron homeostasis during hypoxia." Blood. 102(9):3404-3411. PMID:12855587
  21. [ + ] Nunez MT, et al. (2003) "Iron-activated iron uptake: a positive feedback loop mediated by iron regulatory protein 1." Biometals. 16(1):83-90. PMID:12572667
  22. [ + ] Brazzolotto X, et al. (2002) "Structural changes associated with switching activities of human iron regulatory protein 1." J Biol Chem. 277(14):11995-12000. PMID:11812787
  23. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  24. [ + ] Neonaki M, et al. (2002) "Down-regulation of liver iron-regulatory protein 1 in haemochromatosis." Biochem Soc Trans. 30(4):726-728. PMID:12196178
  25. [ + ] Lee PL, et al. (2001) "A study of genes that may modulate the expression of hereditary hemochromatosis: transferrin receptor-1, ferroportin, ceruloplasmin, ferritin light and heavy chains, iron regulatory proteins (IRP)-1 and -2, and hepcidin." Blood Cells Mol Dis. 27(5):783-802. PMID:11783942
  26. [ + ] Ye Z, et al. (2000) "cDNA cloning by amplification of circularized first strand cDNAs reveals non-IRE-regulated iron-responsive mRNAs." Biochem Biophys Res Commun. 275(1):223-227. PMID:10944468
  27. [ + ] Brazzolotto X, et al. (1999) "Human cytoplasmic aconitase (Iron regulatory protein 1) is converted into its [3Fe-4S] form by hydrogen peroxide in vitro but is not activated for iron-responsive element binding." J Biol Chem. 274(31):21625-21630. PMID:10419470
  28. [ + ] Gruer MJ, et al. (1997) "The aconitase family: three structural variations on a common theme." Trends Biochem Sci. 22(1):3-6. PMID:9020582
  29. [ + ] Hu J, et al. (1996) "Demonstration and characterization of the iron regulatory protein in human brain." J Neurochem. 67(2):838-844. PMID:8764614
  30. [ + ] Eisenstein RS, et al. (1993) "Iron-responsive element-binding protein. Phosphorylation by protein kinase C." J Biol Chem. 268(36):27363-27370. PMID:8262977
  31. [ + ] Hirling H, et al. (1992) "Expression of active iron regulatory factor from a full-length human cDNA by in vitro transcription/translation." Nucleic Acids Res. 20(1):33-39. PMID:1738601
  32. [ + ] Hentze MW, et al. (1991) "Homology between IRE-BP, a regulatory RNA-binding protein, aconitase, and isopropylmalate isomerase." Nucleic Acids Res. 19(8):1739-1740. PMID:1903202
  33. [ + ] Kaptain S, et al. (1991) "A regulated RNA binding protein also possesses aconitase activity." Proc Natl Acad Sci U S A. 88(22):10109-10113. PMID:1946430
  34. [ + ] Rouault TA, et al. (1990) "Cloning of the cDNA encoding an RNA regulatory protein--the human iron-responsive element-binding protein." Proc Natl Acad Sci U S A. 87(20):7958-7962. PMID:2172968
  35. [ + ] Hentze MW, et al. (1989) "Chromosomal localization of nucleic acid-binding proteins by affinity mapping: assignment of the IRE-binding protein gene to human chromosome 9." Nucleic Acids Res. 17(15):6103-6108. PMID:2771641