ABCD3 | GeneID:479939 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 479939 Official Symbol ABCD3
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family D (ALD), member 3
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 2140

ID Symbol Protein Species
GeneID:5825 ABCD3 NP_002849.1 Homo sapiens
GeneID:19299 Abcd3 NP_033017.2 Mus musculus
GeneID:25270 Abcd3 NP_036936.1 Rattus norvegicus
GeneID:32992 CG12703 NP_608354.1 Drosophila melanogaster
GeneID:174126 pmp-1 NP_495407.1 Caenorhabditis elegans
GeneID:174127 pmp-2 NP_495408.1 Caenorhabditis elegans
GeneID:406803 abcd3a NP_998647.1 Danio rerio
GeneID:424487 ABCD3 NP_001012615.1 Gallus gallus
GeneID:457037 ABCD3 XP_513575.2 Pan troglodytes
GeneID:479939 ABCD3 XP_537064.2 Canis lupus familiaris
GeneID:526059 ABCD3 XP_604418.3 Bos taurus
GeneID:830144 PXA1 NP_568072.1 Arabidopsis thaliana
GeneID:1271802 AgaP_AGAP000440 XP_310656.2 Anopheles gambiae
GeneID:4337574 Os05g0107600 NP_001054425.1 Oryza sativa

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_537064 XP_537064

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000032011 MI0000744 hsa-miR-299-5p UGGUUUACCGUCCCACAUACAU
ENSCAFT00000032011 MI0000738 hsa-miR-302a UAAGUGCUUCCAUGUUUUGGUGA
ENSCAFT00000032011 MI0000772 hsa-miR-302b UAAGUGCUUCCAUGUUUUAGUAG
ENSCAFT00000032011 MI0000774 hsa-miR-302d UAAGUGCUUCCAUGUUUGAGUGU
ENSCAFT00000032011 MI0000806 hsa-miR-337-3p CUCCUAUAUGAUGCCUUUCUUC
ENSCAFT00000032011 MI0000091 hsa-miR-33a GUGCAUUGUAGUUGCAUUGCA
ENSCAFT00000032011 MI0003646 hsa-miR-33b GUGCAUUGCUGUUGCAUUGC
ENSCAFT00000032011 MI0003177 hsa-miR-522 AAAAUGGUUCCCUUUAGAGUGU
ENSCAFT00000032011 MI0003589 hsa-miR-582-3p UAACUGGUUGAACAACUGAACC
ENSCAFT00000032011 MI0003591 hsa-miR-584 UUAUGGUUUGCCUGGGACUGAG
ENSCAFT00000032011 MI0003594 hsa-miR-586 UAUGCAUUGUAUUUUUAGGUCC
ENSCAFT00000032011 MI0003597 hsa-miR-588 UUGGCCACAAUGGGUUAGAAC
ENSCAFT00000032011 MI0003681 hsa-miR-657 GGCAGGUUCUCACCCUCUCUAGG
ENSCAFT00000032011 MI0005528 hsa-miR-892a CACUGUGUCCUUUCUGCGUAG
ENSCAFT00000032011 MI0005769 hsa-miR-944 AAAUUAUUGUACAUCGGAUGAG
ENSCAFT00000032011 MI0004671 mmu-miR-467b GUAAGUGCCUGCAUGUAUAUG
ENSCAFT00000032011 MI0006128 mmu-miR-467e AUAAGUGUGAGCAUGUAUAUGU
ENSCAFT00000032011 MI0003523 mmu-miR-547 CUUGGUACAUCUUUGAGUGAG
ENSCAFT00000032011 MI0004685 mmu-miR-701 UUAGCCGCUGAAAUAGAUGGA
ENSCAFT00000032011 MI0005474 mmu-miR-881 AACUGUGUCUUUUCUGAAUAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_537064  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene